Incidental Mutation 'R8323:Dcbld2'
ID643949
Institutional Source Beutler Lab
Gene Symbol Dcbld2
Ensembl Gene ENSMUSG00000035107
Gene Namediscoidin, CUB and LCCL domain containing 2
SynonymsEsdn, 1700055P21Rik, CLCP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8323 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location58408443-58469727 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 58463110 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046663]
Predicted Effect probably null
Transcript: ENSMUST00000046663
SMART Domains Protein: ENSMUSP00000039915
Gene: ENSMUSG00000035107

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
CUB 69 184 4.26e-37 SMART
LCCL 188 273 4.74e-37 SMART
FA58C 288 446 4.08e-28 SMART
transmembrane domain 522 544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced postnatal angiogenesis and impaired recovery from femoral artery ligation with impaired blood flow and decreased capillary density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A T 7: 127,384,449 C494S possibly damaging Het
A3galt2 T C 4: 128,755,558 F6S probably benign Het
Braf T C 6: 39,643,124 T507A possibly damaging Het
Catsperb A C 12: 101,409,399 H24P probably benign Het
Ccdc57 G T 11: 120,897,924 Q366K possibly damaging Het
Cep295 G T 9: 15,338,233 T462K possibly damaging Het
Cep295 T A 9: 15,353,061 R96S probably damaging Het
Cfap206 C T 4: 34,719,647 E256K probably benign Het
Cldn13 A G 5: 134,914,974 V119A probably benign Het
Csmd1 G T 8: 17,216,735 C58* probably null Het
Csmd3 T C 15: 47,698,151 Y1343C Het
Dnah14 A G 1: 181,704,544 I2299V probably benign Het
Dsp C T 13: 38,172,830 H229Y possibly damaging Het
Fam193b A T 13: 55,554,410 C51* probably null Het
Fbxw10 G A 11: 62,876,680 V781I probably benign Het
Fdps G T 3: 89,095,389 P151T possibly damaging Het
Galk2 C T 2: 125,866,378 H16Y probably benign Het
Gm1110 A G 9: 26,902,423 probably null Het
Gm340 T C 19: 41,583,597 S264P probably benign Het
Gm3727 C T 14: 7,261,693 V204I probably benign Het
Gtf2h3 A G 5: 124,582,471 I13V probably benign Het
H2-T24 T A 17: 36,017,539 probably null Het
Heatr5a C T 12: 51,955,506 V216M probably benign Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Igfbp2 C T 1: 72,849,621 P224S probably damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Kif11 T A 19: 37,384,244 F27I possibly damaging Het
Lrrc28 G T 7: 67,595,707 T137K unknown Het
Lyg1 T A 1: 37,949,937 R67S probably damaging Het
Ms4a10 G A 19: 10,962,999 Q255* probably null Het
Myo1h A G 5: 114,342,139 R512G Het
Nmnat3 T C 9: 98,410,223 Y174H probably damaging Het
Nrap T C 19: 56,389,823 I19V probably benign Het
Nsf C A 11: 103,928,839 V35L probably benign Het
Olfr1361 T A 13: 21,659,132 M64L possibly damaging Het
Olfr390 A T 11: 73,786,940 M1L probably damaging Het
Osbpl9 A G 4: 109,107,922 S116P probably benign Het
Pcdhb15 A C 18: 37,475,662 E649A probably benign Het
Pcdhb8 T A 18: 37,355,423 D51E probably benign Het
Plcl1 T A 1: 55,697,736 D745E possibly damaging Het
Prss3 A G 6: 41,374,324 L165P probably damaging Het
Psme4 T A 11: 30,843,532 I1211N probably damaging Het
Rb1 A G 14: 73,265,583 V416A probably benign Het
Rnf111 T A 9: 70,475,922 Q243L probably benign Het
Sacm1l T C 9: 123,548,922 V89A probably benign Het
Sardh C T 2: 27,235,564 D313N probably damaging Het
Scin T C 12: 40,079,682 I371V probably benign Het
Scn10a C A 9: 119,609,396 L1801F possibly damaging Het
Sele G A 1: 164,051,638 V281M possibly damaging Het
Slc17a1 C A 13: 23,887,999 T400K probably damaging Het
Slc22a28 T A 19: 8,131,424 D118V probably damaging Het
Slc2a10 T A 2: 165,514,751 F110L probably benign Het
Slc51a A G 16: 32,476,379 S294P probably damaging Het
Snapc4 T C 2: 26,364,699 E1271G probably benign Het
Spata31 C A 13: 64,922,251 Q738K possibly damaging Het
Spdya A G 17: 71,588,592 D284G probably benign Het
Tdrd5 T C 1: 156,267,262 D757G possibly damaging Het
Tmem104 T C 11: 115,243,373 F245S probably damaging Het
Tmem170 A T 8: 111,876,521 S39T probably benign Het
Trim24 G T 6: 37,915,298 probably null Het
Uap1 A G 1: 170,151,066 V302A probably damaging Het
Vmn2r96 A T 17: 18,582,761 Y311F probably damaging Het
Wdhd1 A T 14: 47,274,795 D46E possibly damaging Het
Wdr66 A G 5: 123,297,525 N1016S probably benign Het
Zdbf2 G A 1: 63,302,914 V151I possibly damaging Het
Zfp943 A G 17: 21,992,782 Q283R possibly damaging Het
Zfp944 A T 17: 22,339,254 D337E probably benign Het
Other mutations in Dcbld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Dcbld2 APN 16 58408873 missense possibly damaging 0.75
IGL01978:Dcbld2 APN 16 58464319 missense probably benign 0.00
IGL02143:Dcbld2 APN 16 58448526 critical splice donor site probably null
IGL02953:Dcbld2 APN 16 58451737 missense probably benign 0.29
IGL03109:Dcbld2 APN 16 58456402 missense probably benign 0.06
IGL03131:Dcbld2 APN 16 58451688 missense probably benign 0.00
R0183:Dcbld2 UTSW 16 58445359 missense possibly damaging 0.70
R0305:Dcbld2 UTSW 16 58448939 missense probably damaging 1.00
R0316:Dcbld2 UTSW 16 58433445 missense probably damaging 1.00
R0371:Dcbld2 UTSW 16 58450823 missense probably benign 0.09
R0548:Dcbld2 UTSW 16 58455145 missense probably damaging 0.98
R0751:Dcbld2 UTSW 16 58449841 critical splice donor site probably null
R0906:Dcbld2 UTSW 16 58455247 missense probably damaging 1.00
R1184:Dcbld2 UTSW 16 58449841 critical splice donor site probably null
R1557:Dcbld2 UTSW 16 58465350 missense possibly damaging 0.49
R1995:Dcbld2 UTSW 16 58456332 missense probably benign
R3930:Dcbld2 UTSW 16 58465338 missense probably damaging 1.00
R3931:Dcbld2 UTSW 16 58465338 missense probably damaging 1.00
R4080:Dcbld2 UTSW 16 58465373 missense probably damaging 1.00
R4385:Dcbld2 UTSW 16 58463066 missense probably damaging 0.96
R4615:Dcbld2 UTSW 16 58456094 missense probably benign 0.03
R4739:Dcbld2 UTSW 16 58460976 missense probably damaging 1.00
R4963:Dcbld2 UTSW 16 58465782 missense probably benign
R4968:Dcbld2 UTSW 16 58424711 missense probably damaging 1.00
R5419:Dcbld2 UTSW 16 58455258 missense probably damaging 0.99
R5684:Dcbld2 UTSW 16 58449809 missense possibly damaging 0.90
R5737:Dcbld2 UTSW 16 58460985 missense probably damaging 1.00
R6277:Dcbld2 UTSW 16 58451756 missense probably damaging 0.97
R6277:Dcbld2 UTSW 16 58465503 missense probably damaging 1.00
R6468:Dcbld2 UTSW 16 58433373 nonsense probably null
R6753:Dcbld2 UTSW 16 58456130 missense possibly damaging 0.94
R7213:Dcbld2 UTSW 16 58450763 missense probably benign 0.02
R7360:Dcbld2 UTSW 16 58465320 splice site probably null
R7555:Dcbld2 UTSW 16 58448718 splice site probably null
R7570:Dcbld2 UTSW 16 58424569 missense possibly damaging 0.86
R7593:Dcbld2 UTSW 16 58424578 missense possibly damaging 0.82
R8072:Dcbld2 UTSW 16 58463097 nonsense probably null
R8175:Dcbld2 UTSW 16 58433347 missense possibly damaging 0.63
R8193:Dcbld2 UTSW 16 58464010 splice site probably null
R8804:Dcbld2 UTSW 16 58461049 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- CTTGCCACTGCTAGTTGTGAC -3'
(R):5'- ACCAACTTTCCAGAGGAAGAG -3'

Sequencing Primer
(F):5'- GTGAGGACATGAATATAGTGTGTATG -3'
(R):5'- ACTGTGTGAGGATGTCAGATACCC -3'
Posted On2020-09-02