Incidental Mutation 'R8323:Gm340'
ID643960
Institutional Source Beutler Lab
Gene Symbol Gm340
Ensembl Gene ENSMUSG00000090673
Gene Namepredicted gene 340
SynonymsLOC381224
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R8323 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location41582370-41586536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41583597 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 264 (S264P)
Ref Sequence ENSEMBL: ENSMUSP00000128083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172371]
Predicted Effect probably benign
Transcript: ENSMUST00000172371
AA Change: S264P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000128083
Gene: ENSMUSG00000090673
AA Change: S264P

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
low complexity region 768 779 N/A INTRINSIC
Pfam:DUF4553 787 1241 9.7e-179 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A T 7: 127,384,449 C494S possibly damaging Het
A3galt2 T C 4: 128,755,558 F6S probably benign Het
Braf T C 6: 39,643,124 T507A possibly damaging Het
Catsperb A C 12: 101,409,399 H24P probably benign Het
Ccdc57 G T 11: 120,897,924 Q366K possibly damaging Het
Cep295 G T 9: 15,338,233 T462K possibly damaging Het
Cep295 T A 9: 15,353,061 R96S probably damaging Het
Cfap206 C T 4: 34,719,647 E256K probably benign Het
Cldn13 A G 5: 134,914,974 V119A probably benign Het
Csmd1 G T 8: 17,216,735 C58* probably null Het
Csmd3 T C 15: 47,698,151 Y1343C Het
Dcbld2 T A 16: 58,463,110 probably null Het
Dnah14 A G 1: 181,704,544 I2299V probably benign Het
Dsp C T 13: 38,172,830 H229Y possibly damaging Het
Fam193b A T 13: 55,554,410 C51* probably null Het
Fbxw10 G A 11: 62,876,680 V781I probably benign Het
Fdps G T 3: 89,095,389 P151T possibly damaging Het
Galk2 C T 2: 125,866,378 H16Y probably benign Het
Gm1110 A G 9: 26,902,423 probably null Het
Gm3727 C T 14: 7,261,693 V204I probably benign Het
Gtf2h3 A G 5: 124,582,471 I13V probably benign Het
H2-T24 T A 17: 36,017,539 probably null Het
Heatr5a C T 12: 51,955,506 V216M probably benign Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Igfbp2 C T 1: 72,849,621 P224S probably damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Kif11 T A 19: 37,384,244 F27I possibly damaging Het
Lrrc28 G T 7: 67,595,707 T137K unknown Het
Lyg1 T A 1: 37,949,937 R67S probably damaging Het
Ms4a10 G A 19: 10,962,999 Q255* probably null Het
Myo1h A G 5: 114,342,139 R512G Het
Nmnat3 T C 9: 98,410,223 Y174H probably damaging Het
Nrap T C 19: 56,389,823 I19V probably benign Het
Nsf C A 11: 103,928,839 V35L probably benign Het
Olfr1361 T A 13: 21,659,132 M64L possibly damaging Het
Olfr390 A T 11: 73,786,940 M1L probably damaging Het
Osbpl9 A G 4: 109,107,922 S116P probably benign Het
Pcdhb15 A C 18: 37,475,662 E649A probably benign Het
Pcdhb8 T A 18: 37,355,423 D51E probably benign Het
Plcl1 T A 1: 55,697,736 D745E possibly damaging Het
Prss3 A G 6: 41,374,324 L165P probably damaging Het
Psme4 T A 11: 30,843,532 I1211N probably damaging Het
Rb1 A G 14: 73,265,583 V416A probably benign Het
Rnf111 T A 9: 70,475,922 Q243L probably benign Het
Sacm1l T C 9: 123,548,922 V89A probably benign Het
Sardh C T 2: 27,235,564 D313N probably damaging Het
Scin T C 12: 40,079,682 I371V probably benign Het
Scn10a C A 9: 119,609,396 L1801F possibly damaging Het
Sele G A 1: 164,051,638 V281M possibly damaging Het
Slc17a1 C A 13: 23,887,999 T400K probably damaging Het
Slc22a28 T A 19: 8,131,424 D118V probably damaging Het
Slc2a10 T A 2: 165,514,751 F110L probably benign Het
Slc51a A G 16: 32,476,379 S294P probably damaging Het
Snapc4 T C 2: 26,364,699 E1271G probably benign Het
Spata31 C A 13: 64,922,251 Q738K possibly damaging Het
Spdya A G 17: 71,588,592 D284G probably benign Het
Tdrd5 T C 1: 156,267,262 D757G possibly damaging Het
Tmem104 T C 11: 115,243,373 F245S probably damaging Het
Tmem170 A T 8: 111,876,521 S39T probably benign Het
Trim24 G T 6: 37,915,298 probably null Het
Uap1 A G 1: 170,151,066 V302A probably damaging Het
Vmn2r96 A T 17: 18,582,761 Y311F probably damaging Het
Wdhd1 A T 14: 47,274,795 D46E possibly damaging Het
Wdr66 A G 5: 123,297,525 N1016S probably benign Het
Zdbf2 G A 1: 63,302,914 V151I possibly damaging Het
Zfp943 A G 17: 21,992,782 Q283R possibly damaging Het
Zfp944 A T 17: 22,339,254 D337E probably benign Het
Other mutations in Gm340
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB003:Gm340 UTSW 19 41582569 missense probably benign
BB013:Gm340 UTSW 19 41582569 missense probably benign
R0006:Gm340 UTSW 19 41584899 missense probably benign 0.00
R0686:Gm340 UTSW 19 41582372 missense possibly damaging 0.73
R1104:Gm340 UTSW 19 41586063 missense probably damaging 0.99
R1278:Gm340 UTSW 19 41584683 missense probably benign 0.07
R1606:Gm340 UTSW 19 41585074 missense probably benign 0.35
R1833:Gm340 UTSW 19 41584948 missense probably benign 0.00
R1905:Gm340 UTSW 19 41583574 missense possibly damaging 0.73
R2697:Gm340 UTSW 19 41584027 missense probably benign 0.43
R2881:Gm340 UTSW 19 41583049 missense probably damaging 1.00
R4720:Gm340 UTSW 19 41585895 missense probably benign 0.04
R4864:Gm340 UTSW 19 41585364 missense probably benign
R4908:Gm340 UTSW 19 41584162 missense probably benign 0.00
R5193:Gm340 UTSW 19 41582530 missense probably damaging 1.00
R5215:Gm340 UTSW 19 41585932 missense probably damaging 1.00
R5276:Gm340 UTSW 19 41585039 missense probably damaging 0.98
R5319:Gm340 UTSW 19 41586352 missense probably damaging 0.99
R5321:Gm340 UTSW 19 41585204 missense probably damaging 1.00
R5432:Gm340 UTSW 19 41584603 missense probably damaging 1.00
R5605:Gm340 UTSW 19 41582863 missense probably damaging 1.00
R5941:Gm340 UTSW 19 41586400 missense probably damaging 1.00
R6020:Gm340 UTSW 19 41583547 missense possibly damaging 0.88
R6024:Gm340 UTSW 19 41583957 missense possibly damaging 0.84
R6149:Gm340 UTSW 19 41585202 missense probably damaging 1.00
R6260:Gm340 UTSW 19 41582370 missense probably null 0.91
R6260:Gm340 UTSW 19 41582371 missense possibly damaging 0.73
R6476:Gm340 UTSW 19 41583079 missense probably benign 0.04
R7051:Gm340 UTSW 19 41585752 missense probably benign 0.05
R7285:Gm340 UTSW 19 41584315 missense possibly damaging 0.91
R7372:Gm340 UTSW 19 41585506 missense probably damaging 1.00
R7762:Gm340 UTSW 19 41583667 missense probably benign 0.02
R7833:Gm340 UTSW 19 41584585 missense probably benign 0.02
R7926:Gm340 UTSW 19 41582569 missense probably benign
R8164:Gm340 UTSW 19 41585410 missense probably damaging 1.00
R8319:Gm340 UTSW 19 41582904 missense probably damaging 1.00
R8327:Gm340 UTSW 19 41582557 missense probably damaging 1.00
R8423:Gm340 UTSW 19 41585449 missense possibly damaging 0.95
X0013:Gm340 UTSW 19 41584532 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCCAGCTTTCCTCAGTAGG -3'
(R):5'- AGGTGAGACCACAATGCTG -3'

Sequencing Primer
(F):5'- GCTTTCCTCAGTAGGTACACAAC -3'
(R):5'- GAGACCACAATGCTGCCTTCTG -3'
Posted On2020-09-02