Incidental Mutation 'R8324:Pax3'
ID 643962
Institutional Source Beutler Lab
Gene Symbol Pax3
Ensembl Gene ENSMUSG00000004872
Gene Name paired box 3
Synonyms Splchl2, Pax-3
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.822) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 78077904-78173771 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78170426 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 134 (R134S)
Ref Sequence ENSEMBL: ENSMUSP00000004994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004994] [ENSMUST00000087086]
AlphaFold P24610
Predicted Effect probably damaging
Transcript: ENSMUST00000004994
AA Change: R134S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004994
Gene: ENSMUSG00000004872
AA Change: R134S

DomainStartEndE-ValueType
PAX 34 159 1.99e-91 SMART
low complexity region 164 185 N/A INTRINSIC
HOX 219 281 6.6e-27 SMART
Pfam:Pax7 347 391 5.9e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000087086
AA Change: R134S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084320
Gene: ENSMUSG00000004872
AA Change: R134S

DomainStartEndE-ValueType
PAX 34 159 1.99e-91 SMART
low complexity region 164 185 N/A INTRINSIC
HOX 219 281 6.6e-27 SMART
Pfam:Pax7 346 391 5.3e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008]
PHENOTYPE: Effects on homozygotes for mutations in this gene vary in severity and include embryonic to perinatal death, malformations of neural tube, spinal ganglia, heart, vertebral column, hindbrain and limb musculature. Heterozygotes have white belly spots and variable spotting on the back and extremeties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Pax3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Pax3 APN 1 78,173,300 (GRCm39) critical splice donor site probably null
IGL02249:Pax3 APN 1 78,171,962 (GRCm39) missense probably damaging 0.98
IGL02271:Pax3 APN 1 78,171,969 (GRCm39) missense probably damaging 1.00
IGL02376:Pax3 APN 1 78,108,929 (GRCm39) missense probably damaging 1.00
IGL02530:Pax3 APN 1 78,098,424 (GRCm39) missense possibly damaging 0.87
IGL02950:Pax3 APN 1 78,079,997 (GRCm39) missense probably benign 0.06
Nidoqueen UTSW 1 78,108,869 (GRCm39) missense probably damaging 1.00
Widget UTSW 1 78,099,227 (GRCm39) critical splice donor site probably null
R0049:Pax3 UTSW 1 78,080,141 (GRCm39) missense probably damaging 1.00
R0049:Pax3 UTSW 1 78,080,141 (GRCm39) missense probably damaging 1.00
R0523:Pax3 UTSW 1 78,172,078 (GRCm39) missense possibly damaging 0.83
R1575:Pax3 UTSW 1 78,080,121 (GRCm39) missense probably benign 0.00
R1831:Pax3 UTSW 1 78,108,977 (GRCm39) missense probably damaging 1.00
R1934:Pax3 UTSW 1 78,080,117 (GRCm39) missense possibly damaging 0.90
R2420:Pax3 UTSW 1 78,173,501 (GRCm39) splice site probably null
R2473:Pax3 UTSW 1 78,099,227 (GRCm39) critical splice donor site probably null
R4430:Pax3 UTSW 1 78,171,961 (GRCm39) missense probably damaging 1.00
R4693:Pax3 UTSW 1 78,173,383 (GRCm39) missense probably benign 0.00
R4818:Pax3 UTSW 1 78,108,869 (GRCm39) missense probably damaging 1.00
R4860:Pax3 UTSW 1 78,169,093 (GRCm39) missense possibly damaging 0.78
R4860:Pax3 UTSW 1 78,169,093 (GRCm39) missense possibly damaging 0.78
R5302:Pax3 UTSW 1 78,098,249 (GRCm39) missense possibly damaging 0.88
R5475:Pax3 UTSW 1 78,080,055 (GRCm39) missense probably benign 0.06
R5855:Pax3 UTSW 1 78,098,288 (GRCm39) missense probably damaging 0.99
R6102:Pax3 UTSW 1 78,108,984 (GRCm39) missense probably damaging 1.00
R6190:Pax3 UTSW 1 78,169,186 (GRCm39) missense possibly damaging 0.63
R6856:Pax3 UTSW 1 78,109,056 (GRCm39) missense probably damaging 1.00
R7065:Pax3 UTSW 1 78,170,648 (GRCm39) splice site probably null
R7547:Pax3 UTSW 1 78,099,231 (GRCm39) nonsense probably null
R8059:Pax3 UTSW 1 78,080,003 (GRCm39) missense probably benign 0.04
R8224:Pax3 UTSW 1 78,098,327 (GRCm39) missense probably damaging 1.00
R8312:Pax3 UTSW 1 78,172,006 (GRCm39) missense probably damaging 1.00
R9319:Pax3 UTSW 1 78,080,079 (GRCm39) missense probably benign
R9759:Pax3 UTSW 1 78,170,415 (GRCm39) missense probably damaging 1.00
Z1176:Pax3 UTSW 1 78,099,227 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCAGGTCAGCCTCCCAATAG -3'
(R):5'- CTGTCATCTCCTGTCTAAACGG -3'

Sequencing Primer
(F):5'- CTCCCAATAGCCAAGATGGATAATTG -3'
(R):5'- CTTTGGCTAAGCAGAGGGACATTC -3'
Posted On 2020-09-02