Mutagenetix > Incidental Mutation

Incidental Mutation 'R8324:Pax3'

643962

Institutional Source

Beutler Lab

Gene Symbol

Pax3

Ensembl Gene

ENSMUSG00000004872

Gene Name

paired box 3

Synonyms

Pax-3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.834) question?

Stock #

R8324 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

78101267-78197134 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 78193789 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 134 (R134S)

Ref Sequence

ENSEMBL: ENSMUSP00000004994 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004994] [ENSMUST00000087086]

AlphaFold

P24610

Predicted Effect

probably damaging
Transcript: ENSMUST00000004994
AA Change: R134S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000004994
Gene: ENSMUSG00000004872
AA Change: R134S

Domain	Start	End	E-Value	Type
PAX	34	159	1.99e-91	SMART
low complexity region	164	185	N/A	INTRINSIC
HOX	219	281	6.6e-27	SMART
Pfam:Pax7	347	391	5.9e-29	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087086
AA Change: R134S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000084320
Gene: ENSMUSG00000004872
AA Change: R134S

Domain	Start	End	E-Value	Type
PAX	34	159	1.99e-91	SMART
low complexity region	164	185	N/A	INTRINSIC
HOX	219	281	6.6e-27	SMART
Pfam:Pax7	346	391	5.3e-27	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008]
PHENOTYPE: Effects on homozygotes for mutations in this gene vary in severity and include embryonic to perinatal death, malformations of neural tube, spinal ganglia, heart, vertebral column, hindbrain and limb musculature. Heterozygotes have white belly spots and variable spotting on the back and extremeties. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,290,395	S753P	probably damaging	Het
Acan	A	G	7: 79,091,056	E390G	probably damaging	Het
Antxr2	T	C	5: 97,938,509	N413S	probably damaging	Het
Bace2	C	T	16: 97,356,908	A36V	possibly damaging	Het
Caprin1	G	A	2: 103,783,181	R79*	probably null	Het
Cdan1	A	G	2: 120,727,325	V507A	probably benign	Het
Cdkl3	T	A	11: 52,022,879		probably null	Het
Chst5	A	T	8: 111,890,508	L160Q	probably benign	Het
Col11a1	C	G	3: 114,164,410	P1111R	probably damaging	Het
Col6a6	T	A	9: 105,755,654	E1470D	probably benign	Het
Cpped1	T	A	16: 11,805,476	T274S	probably benign	Het
Ctnnbl1	G	A	2: 157,779,815	E75K	probably damaging	Het
Cyp4f40	T	C	17: 32,659,528	S15P	probably benign	Het
Ddx46	T	C	13: 55,663,914	S643P	probably damaging	Het
Defb34	A	G	8: 19,123,798	Q16R	probably null	Het
Dhrs2	T	A	14: 55,238,764	V147E	probably damaging	Het
Dnah5	G	T	15: 28,346,865	R2498L	probably damaging	Het
Dpp10	T	A	1: 123,854,172	I93F	probably benign	Het
Eef1e1	T	A	13: 38,655,069	D104V	probably damaging	Het
Egfr	A	G	11: 16,858,971	Y55C	probably damaging	Het
Egfr	A	C	11: 16,908,885	I955L	probably damaging	Het
Ehbp1l1	C	A	19: 5,719,998	V426F	possibly damaging	Het
Fam234a	C	T	17: 26,218,698	V108I	probably benign	Het
Fzd8	T	A	18: 9,214,688	M590K	probably damaging	Het
Gm13287	T	C	4: 88,803,638	S129P	probably damaging	Het
Heatr5b	A	G	17: 78,755,364	S1919P	possibly damaging	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Ikbkap	C	T	4: 56,772,491	E877K	probably damaging	Het
Itpr2	T	C	6: 146,328,398	E1233G	probably damaging	Het
Kcnmb4	A	G	10: 116,418,314	L186P	probably damaging	Het
Krt72	T	A	15: 101,782,145	Y224F	probably damaging	Het
Loxhd1	T	C	18: 77,339,579		probably null	Het
Lrguk	A	G	6: 34,102,571	T914A	probably benign	Het
Lrrtm4	A	G	6: 80,021,991	T129A	probably damaging	Het
Mmp13	A	T	9: 7,276,636	I244F	possibly damaging	Het
Mob1a	T	A	6: 83,329,974	L41Q	probably damaging	Het
Mtcl1	T	C	17: 66,436,217	R426G	probably damaging	Het
Mybbp1a	T	C	11: 72,445,288		probably null	Het
Myh9	A	G	15: 77,788,917		probably null	Het
Myo1d	T	A	11: 80,557,521	D926V	probably damaging	Het
Ncapg	T	G	5: 45,695,668	H825Q	probably damaging	Het
Olfml1	T	C	7: 107,590,363	S212P	probably benign	Het
Olfr656	G	A	7: 104,618,114	R145H	probably benign	Het
Pak2	T	C	16: 32,052,211	N51S	probably benign	Het
Papln	T	C	12: 83,786,619	Y1132H	probably damaging	Het
Pdzrn4	A	G	15: 92,770,937	E990G	probably damaging	Het
Peak1	A	T	9: 56,207,476	W1394R	probably damaging	Het
Pkn2	T	C	3: 142,829,010	N285D	probably benign	Het
Pramef12	A	C	4: 144,395,857	L39R	probably damaging	Het
Prrc2a	A	G	17: 35,156,984	S897P	possibly damaging	Het
Rad51	A	G	2: 119,123,831	T131A	possibly damaging	Het
Rc3h2	T	A	2: 37,400,726	T255S	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rictor	T	A	15: 6,745,562	V125E	probably damaging	Het
Rps6ka5	C	T	12: 100,558,487	D664N	possibly damaging	Het
Rreb1	T	A	13: 37,947,621	W1584R	probably damaging	Het
Rxra	T	C	2: 27,741,183	I142T	probably damaging	Het
Sall2	T	C	14: 52,312,886	T951A	probably benign	Het
Slc15a2	T	G	16: 36,759,307	N359T	probably damaging	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Slc6a13	T	C	6: 121,337,414	*603Q	probably null	Het
Sptb	T	C	12: 76,619,162	D894G	possibly damaging	Het
Srgn	A	G	10: 62,507,665	L17P	probably damaging	Het
Tmprss9	T	C	10: 80,897,371		probably null	Het
Trav9n-4	T	C	14: 53,294,946	F86L	probably benign	Het
Trp63	A	G	16: 25,876,734	Y482C	unknown	Het
Ttc9b	G	T	7: 27,653,969	A15S	probably damaging	Het
Urb1	A	T	16: 90,791,190	I410N	probably damaging	Het
Vmn2r82	A	T	10: 79,378,893	K237*	probably null	Het
Wwox	G	A	8: 114,489,005		probably null	Het

Other mutations in Pax3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01642:Pax3	APN	1	78196663	critical splice donor site	probably null
IGL02249:Pax3	APN	1	78195325	missense	probably damaging	0.98
IGL02271:Pax3	APN	1	78195332	missense	probably damaging	1.00
IGL02376:Pax3	APN	1	78132292	missense	probably damaging	1.00
IGL02530:Pax3	APN	1	78121787	missense	possibly damaging	0.87
IGL02950:Pax3	APN	1	78103360	missense	probably benign	0.06
Nidoqueen	UTSW	1	78132232	missense	probably damaging	1.00
Widget	UTSW	1	78122590	critical splice donor site	probably null
R0049:Pax3	UTSW	1	78103504	missense	probably damaging	1.00
R0049:Pax3	UTSW	1	78103504	missense	probably damaging	1.00
R0523:Pax3	UTSW	1	78195441	missense	possibly damaging	0.83
R1575:Pax3	UTSW	1	78103484	missense	probably benign	0.00
R1831:Pax3	UTSW	1	78132340	missense	probably damaging	1.00
R1934:Pax3	UTSW	1	78103480	missense	possibly damaging	0.90
R2420:Pax3	UTSW	1	78196864	splice site	probably null
R2473:Pax3	UTSW	1	78122590	critical splice donor site	probably null
R4430:Pax3	UTSW	1	78195324	missense	probably damaging	1.00
R4693:Pax3	UTSW	1	78196746	missense	probably benign	0.00
R4818:Pax3	UTSW	1	78132232	missense	probably damaging	1.00
R4860:Pax3	UTSW	1	78192456	missense	possibly damaging	0.78
R4860:Pax3	UTSW	1	78192456	missense	possibly damaging	0.78
R5302:Pax3	UTSW	1	78121612	missense	possibly damaging	0.88
R5475:Pax3	UTSW	1	78103418	missense	probably benign	0.06
R5855:Pax3	UTSW	1	78121651	missense	probably damaging	0.99
R6102:Pax3	UTSW	1	78132347	missense	probably damaging	1.00
R6190:Pax3	UTSW	1	78192549	missense	possibly damaging	0.63
R6856:Pax3	UTSW	1	78132419	missense	probably damaging	1.00
R7065:Pax3	UTSW	1	78194011	splice site	probably null
R7547:Pax3	UTSW	1	78122594	nonsense	probably null
R8059:Pax3	UTSW	1	78103366	missense	probably benign	0.04
R8224:Pax3	UTSW	1	78121690	missense	probably damaging	1.00
R8312:Pax3	UTSW	1	78195369	missense	probably damaging	1.00
R9319:Pax3	UTSW	1	78103442	missense	probably benign
R9759:Pax3	UTSW	1	78193778	missense	probably damaging	1.00
Z1176:Pax3	UTSW	1	78122590	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTCAGGTCAGCCTCCCAATAG -3'
(R):5'- CTGTCATCTCCTGTCTAAACGG -3'

Sequencing Primer
(F):5'- CTCCCAATAGCCAAGATGGATAATTG -3'
(R):5'- CTTTGGCTAAGCAGAGGGACATTC -3'

Posted On

2020-09-02