Incidental Mutation 'R8324:Dpp10'
ID 643963
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Name dipeptidylpeptidase 10
Synonyms 6430601K09Rik, DPRP3
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 123259871-124773774 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 123781901 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 93 (I93F)
Ref Sequence ENSEMBL: ENSMUSP00000108225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000112603
AA Change: I82F

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: I82F

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112606
AA Change: I93F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: I93F

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123,262,099 (GRCm39) missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123,295,596 (GRCm39) missense probably benign
IGL02101:Dpp10 APN 1 123,339,555 (GRCm39) missense probably damaging 1.00
IGL02284:Dpp10 APN 1 123,973,103 (GRCm39) splice site probably benign
IGL02324:Dpp10 APN 1 123,295,531 (GRCm39) missense probably benign 0.02
IGL02391:Dpp10 APN 1 123,578,087 (GRCm39) missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123,269,418 (GRCm39) missense probably benign 0.01
IGL02469:Dpp10 APN 1 123,339,532 (GRCm39) missense probably benign 0.01
IGL02501:Dpp10 APN 1 123,613,999 (GRCm39) missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123,351,381 (GRCm39) missense probably benign 0.24
IGL02672:Dpp10 APN 1 123,304,376 (GRCm39) missense probably benign 0.45
IGL03034:Dpp10 APN 1 123,269,348 (GRCm39) missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123,268,911 (GRCm39) splice site probably benign
R0104:Dpp10 UTSW 1 123,295,572 (GRCm39) missense probably benign 0.00
R0114:Dpp10 UTSW 1 123,413,821 (GRCm39) missense probably benign 0.07
R0242:Dpp10 UTSW 1 123,326,275 (GRCm39) missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123,326,275 (GRCm39) missense possibly damaging 0.56
R0682:Dpp10 UTSW 1 123,832,852 (GRCm39) missense probably damaging 0.98
R0815:Dpp10 UTSW 1 123,360,658 (GRCm39) critical splice donor site probably null
R1549:Dpp10 UTSW 1 123,269,109 (GRCm39) critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123,372,935 (GRCm39) missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123,281,333 (GRCm39) missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123,832,833 (GRCm39) missense probably null 1.00
R1992:Dpp10 UTSW 1 123,832,833 (GRCm39) missense probably null 1.00
R2079:Dpp10 UTSW 1 123,360,721 (GRCm39) missense probably damaging 1.00
R2882:Dpp10 UTSW 1 123,372,932 (GRCm39) missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123,339,434 (GRCm39) splice site probably benign
R3827:Dpp10 UTSW 1 123,339,519 (GRCm39) missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123,413,653 (GRCm39) nonsense probably null
R3876:Dpp10 UTSW 1 123,281,216 (GRCm39) missense probably damaging 0.98
R3899:Dpp10 UTSW 1 123,281,286 (GRCm39) missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123,326,356 (GRCm39) missense probably benign 0.15
R4922:Dpp10 UTSW 1 123,305,882 (GRCm39) missense probably benign 0.44
R5457:Dpp10 UTSW 1 123,339,539 (GRCm39) missense possibly damaging 0.51
R5599:Dpp10 UTSW 1 123,832,803 (GRCm39) missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123,312,018 (GRCm39) missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123,312,012 (GRCm39) critical splice donor site probably null
R6378:Dpp10 UTSW 1 123,339,468 (GRCm39) missense probably damaging 1.00
R6429:Dpp10 UTSW 1 123,295,330 (GRCm39) missense possibly damaging 0.72
R6505:Dpp10 UTSW 1 123,264,580 (GRCm39) missense probably damaging 0.99
R6776:Dpp10 UTSW 1 123,295,385 (GRCm39) nonsense probably null
R6894:Dpp10 UTSW 1 123,264,593 (GRCm39) missense probably damaging 1.00
R6951:Dpp10 UTSW 1 123,269,379 (GRCm39) missense possibly damaging 0.93
R7182:Dpp10 UTSW 1 123,268,880 (GRCm39) missense probably benign 0.15
R7246:Dpp10 UTSW 1 123,262,106 (GRCm39) missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123,281,157 (GRCm39) nonsense probably null
R7375:Dpp10 UTSW 1 123,295,524 (GRCm39) missense probably benign
R7387:Dpp10 UTSW 1 123,268,869 (GRCm39) missense probably benign 0.01
R7661:Dpp10 UTSW 1 123,312,681 (GRCm39) missense probably damaging 1.00
R8065:Dpp10 UTSW 1 123,280,389 (GRCm39) missense probably benign
R8067:Dpp10 UTSW 1 123,280,389 (GRCm39) missense probably benign
R8260:Dpp10 UTSW 1 123,614,024 (GRCm39) missense probably benign
R8373:Dpp10 UTSW 1 123,781,958 (GRCm39) missense possibly damaging 0.94
R8434:Dpp10 UTSW 1 123,360,739 (GRCm39) missense probably damaging 1.00
R9068:Dpp10 UTSW 1 123,360,667 (GRCm39) missense probably damaging 1.00
R9104:Dpp10 UTSW 1 123,339,484 (GRCm39) missense probably damaging 1.00
R9477:Dpp10 UTSW 1 123,304,370 (GRCm39) missense possibly damaging 0.46
R9492:Dpp10 UTSW 1 123,281,159 (GRCm39) missense probably damaging 1.00
R9524:Dpp10 UTSW 1 123,264,611 (GRCm39) missense probably damaging 1.00
R9576:Dpp10 UTSW 1 123,269,409 (GRCm39) missense probably damaging 1.00
R9631:Dpp10 UTSW 1 123,269,432 (GRCm39) missense probably damaging 1.00
R9736:Dpp10 UTSW 1 123,262,088 (GRCm39) missense possibly damaging 0.64
X0019:Dpp10 UTSW 1 123,326,314 (GRCm39) missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123,326,311 (GRCm39) missense probably benign 0.36
X0021:Dpp10 UTSW 1 123,360,721 (GRCm39) missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123,312,015 (GRCm39) missense probably damaging 1.00
Z1176:Dpp10 UTSW 1 123,281,169 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTTCCATTAAGACAAACAGATGC -3'
(R):5'- CTCACTTCAGATTGATGTCTCATTAGC -3'

Sequencing Primer
(F):5'- AGTACACCACAGTCAGTTCTAC -3'
(R):5'- TGTCTCATTAGCATATATTTTGAGGC -3'
Posted On 2020-09-02