Incidental Mutation 'R8324:Rxra'
ID 643964
Institutional Source Beutler Lab
Gene Symbol Rxra
Ensembl Gene ENSMUSG00000015846
Gene Name retinoid X receptor alpha
Synonyms RXRalpha1, RXR alpha 1, 9530071D11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 27676440-27762957 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27741183 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 142 (I142T)
Ref Sequence ENSEMBL: ENSMUSP00000076491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077257] [ENSMUST00000100251] [ENSMUST00000113934] [ENSMUST00000129514] [ENSMUST00000166775]
AlphaFold P28700
Predicted Effect probably damaging
Transcript: ENSMUST00000077257
AA Change: I142T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076491
Gene: ENSMUSG00000015846
AA Change: I142T

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 18 132 4.2e-42 PFAM
ZnF_C4 137 208 1.76e-40 SMART
Blast:HOLI 233 265 1e-8 BLAST
HOLI 275 434 1.62e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100251
AA Change: I114T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097822
Gene: ENSMUSG00000015846
AA Change: I114T

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 1 104 1.8e-38 PFAM
ZnF_C4 109 180 1.76e-40 SMART
Blast:HOLI 205 237 1e-8 BLAST
HOLI 247 406 1.62e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113934
AA Change: I114T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109567
Gene: ENSMUSG00000015846
AA Change: I114T

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 1 104 1.8e-38 PFAM
ZnF_C4 109 180 1.76e-40 SMART
Blast:HOLI 205 237 1e-8 BLAST
HOLI 247 406 1.62e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129514
AA Change: I114T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115165
Gene: ENSMUSG00000015846
AA Change: I114T

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 1 104 2e-39 PFAM
ZnF_C4 109 165 1.17e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166775
AA Change: I142T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133044
Gene: ENSMUSG00000015846
AA Change: I142T

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 17 132 6.5e-41 PFAM
ZnF_C4 137 208 1.76e-40 SMART
Blast:HOLI 233 265 1e-8 BLAST
HOLI 275 434 1.62e-53 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Null embryos have multiple organ defects and die of cardiac failure by E14.5. Gene ablation in liver, prostate, fat or epidermis tissue-specifically affects development, function and/or neoplasia. Hypomorphic mutants develop alopecia, progressively severe dermal cysts and late corneal opacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,290,395 S753P probably damaging Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Antxr2 T C 5: 97,938,509 N413S probably damaging Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
Caprin1 G A 2: 103,783,181 R79* probably null Het
Cdan1 A G 2: 120,727,325 V507A probably benign Het
Cdkl3 T A 11: 52,022,879 probably null Het
Chst5 A T 8: 111,890,508 L160Q probably benign Het
Col11a1 C G 3: 114,164,410 P1111R probably damaging Het
Col6a6 T A 9: 105,755,654 E1470D probably benign Het
Cpped1 T A 16: 11,805,476 T274S probably benign Het
Ctnnbl1 G A 2: 157,779,815 E75K probably damaging Het
Cyp4f40 T C 17: 32,659,528 S15P probably benign Het
Ddx46 T C 13: 55,663,914 S643P probably damaging Het
Defb34 A G 8: 19,123,798 Q16R probably null Het
Dhrs2 T A 14: 55,238,764 V147E probably damaging Het
Dnah5 G T 15: 28,346,865 R2498L probably damaging Het
Dpp10 T A 1: 123,854,172 I93F probably benign Het
Eef1e1 T A 13: 38,655,069 D104V probably damaging Het
Egfr A G 11: 16,858,971 Y55C probably damaging Het
Egfr A C 11: 16,908,885 I955L probably damaging Het
Ehbp1l1 C A 19: 5,719,998 V426F possibly damaging Het
Fam234a C T 17: 26,218,698 V108I probably benign Het
Fzd8 T A 18: 9,214,688 M590K probably damaging Het
Gm13287 T C 4: 88,803,638 S129P probably damaging Het
Heatr5b A G 17: 78,755,364 S1919P possibly damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ikbkap C T 4: 56,772,491 E877K probably damaging Het
Itpr2 T C 6: 146,328,398 E1233G probably damaging Het
Kcnmb4 A G 10: 116,418,314 L186P probably damaging Het
Krt72 T A 15: 101,782,145 Y224F probably damaging Het
Loxhd1 T C 18: 77,339,579 probably null Het
Lrguk A G 6: 34,102,571 T914A probably benign Het
Lrrtm4 A G 6: 80,021,991 T129A probably damaging Het
Mmp13 A T 9: 7,276,636 I244F possibly damaging Het
Mob1a T A 6: 83,329,974 L41Q probably damaging Het
Mtcl1 T C 17: 66,436,217 R426G probably damaging Het
Mybbp1a T C 11: 72,445,288 probably null Het
Myh9 A G 15: 77,788,917 probably null Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Ncapg T G 5: 45,695,668 H825Q probably damaging Het
Olfml1 T C 7: 107,590,363 S212P probably benign Het
Olfr656 G A 7: 104,618,114 R145H probably benign Het
Pak2 T C 16: 32,052,211 N51S probably benign Het
Papln T C 12: 83,786,619 Y1132H probably damaging Het
Pax3 T A 1: 78,193,789 R134S probably damaging Het
Pdzrn4 A G 15: 92,770,937 E990G probably damaging Het
Peak1 A T 9: 56,207,476 W1394R probably damaging Het
Pkn2 T C 3: 142,829,010 N285D probably benign Het
Pramef12 A C 4: 144,395,857 L39R probably damaging Het
Prrc2a A G 17: 35,156,984 S897P possibly damaging Het
Rad51 A G 2: 119,123,831 T131A possibly damaging Het
Rc3h2 T A 2: 37,400,726 T255S possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rictor T A 15: 6,745,562 V125E probably damaging Het
Rps6ka5 C T 12: 100,558,487 D664N possibly damaging Het
Rreb1 T A 13: 37,947,621 W1584R probably damaging Het
Sall2 T C 14: 52,312,886 T951A probably benign Het
Slc15a2 T G 16: 36,759,307 N359T probably damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc6a13 T C 6: 121,337,414 *603Q probably null Het
Sptb T C 12: 76,619,162 D894G possibly damaging Het
Srgn A G 10: 62,507,665 L17P probably damaging Het
Tmprss9 T C 10: 80,897,371 probably null Het
Trav9n-4 T C 14: 53,294,946 F86L probably benign Het
Trp63 A G 16: 25,876,734 Y482C unknown Het
Ttc9b G T 7: 27,653,969 A15S probably damaging Het
Urb1 A T 16: 90,791,190 I410N probably damaging Het
Vmn2r82 A T 10: 79,378,893 K237* probably null Het
Wwox G A 8: 114,489,005 probably null Het
Other mutations in Rxra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Rxra APN 2 27754241 missense probably damaging 1.00
IGL03006:Rxra APN 2 27759645 missense probably damaging 1.00
pinkie UTSW 2 27752334 missense probably damaging 0.98
R0265:Rxra UTSW 2 27752430 missense probably damaging 1.00
R0578:Rxra UTSW 2 27759570 missense probably damaging 1.00
R1555:Rxra UTSW 2 27748678 missense probably benign 0.00
R1775:Rxra UTSW 2 27756244 missense probably damaging 1.00
R3725:Rxra UTSW 2 27754277 missense probably damaging 1.00
R3756:Rxra UTSW 2 27741911 missense probably damaging 1.00
R3804:Rxra UTSW 2 27756260 missense probably damaging 1.00
R3965:Rxra UTSW 2 27752306 splice site probably benign
R4490:Rxra UTSW 2 27741195 missense probably damaging 0.99
R4898:Rxra UTSW 2 27741183 missense probably damaging 1.00
R5154:Rxra UTSW 2 27757868 critical splice donor site probably null
R5651:Rxra UTSW 2 27737341 missense probably benign 0.25
R6880:Rxra UTSW 2 27748656 missense possibly damaging 0.64
R6913:Rxra UTSW 2 27741174 missense probably damaging 1.00
R7404:Rxra UTSW 2 27741854 missense probably damaging 0.99
R9098:Rxra UTSW 2 27748744 missense possibly damaging 0.50
R9200:Rxra UTSW 2 27737484 missense possibly damaging 0.64
R9356:Rxra UTSW 2 27759663 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTAGTGCCCATCCCCAG -3'
(R):5'- TGGCATACCTCTAGACCACC -3'

Sequencing Primer
(F):5'- ATCCCCAGCCTGCCAGG -3'
(R):5'- CTTGAGGACAAAATGAGACCCCTG -3'
Posted On 2020-09-02