Mutagenetix > Incidental Mutation

Incidental Mutation 'R8324:Rc3h2'

643965

Institutional Source

Beutler Lab

Gene Symbol

Rc3h2

Ensembl Gene

ENSMUSG00000075376

Gene Name

ring finger and CCCH-type zinc finger domains 2

Synonyms

Mnab, D930043C02Rik, Rnf164, 2900024N03Rik, 9430019J22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8324 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

37370069-37422903 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 37400726 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 255 (T255S)

Ref Sequence

ENSEMBL: ENSMUSP00000108556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100143] [ENSMUST00000112934] [ENSMUST00000112936] [ENSMUST00000125619]

AlphaFold

P0C090

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100143
AA Change: T255S

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000097721
Gene: ENSMUSG00000075376
AA Change: T255S

Domain	Start	End	E-Value	Type
RING	14	53	2.87e-5	SMART
low complexity region	198	209	N/A	INTRINSIC
ZnF_C3H1	410	437	1.58e-3	SMART
low complexity region	609	633	N/A	INTRINSIC
low complexity region	668	688	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112934
AA Change: T255S

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000108556
Gene: ENSMUSG00000075376
AA Change: T255S

Domain	Start	End	E-Value	Type
RING	14	53	2.87e-5	SMART
low complexity region	198	209	N/A	INTRINSIC
ZnF_C3H1	410	437	1.58e-3	SMART
low complexity region	609	633	N/A	INTRINSIC
low complexity region	668	688	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112936
AA Change: T255S

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000108558
Gene: ENSMUSG00000075376
AA Change: T255S

Domain	Start	End	E-Value	Type
RING	14	53	2.87e-5	SMART
low complexity region	198	209	N/A	INTRINSIC
ZnF_C3H1	410	437	1.58e-3	SMART
low complexity region	609	633	N/A	INTRINSIC
low complexity region	668	688	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000125619
AA Change: T255S

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000145082
Gene: ENSMUSG00000075376
AA Change: T255S

Domain	Start	End	E-Value	Type
RING	14	53	1.4e-7	SMART
low complexity region	198	209	N/A	INTRINSIC
ZnF_C3H1	410	437	6.9e-6	SMART
low complexity region	455	466	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a knock-out allele are viable and healthy but show increased TNF production by macrophages in response to LPS. Homozygotes for a different knock-out allele show postnatal lethality, decreased body size and weight, and an immature lung phenotype with decreased alveolar expansion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,290,395	S753P	probably damaging	Het
Acan	A	G	7: 79,091,056	E390G	probably damaging	Het
Antxr2	T	C	5: 97,938,509	N413S	probably damaging	Het
Bace2	C	T	16: 97,356,908	A36V	possibly damaging	Het
Caprin1	G	A	2: 103,783,181	R79*	probably null	Het
Cdan1	A	G	2: 120,727,325	V507A	probably benign	Het
Cdkl3	T	A	11: 52,022,879		probably null	Het
Chst5	A	T	8: 111,890,508	L160Q	probably benign	Het
Col11a1	C	G	3: 114,164,410	P1111R	probably damaging	Het
Col6a6	T	A	9: 105,755,654	E1470D	probably benign	Het
Cpped1	T	A	16: 11,805,476	T274S	probably benign	Het
Ctnnbl1	G	A	2: 157,779,815	E75K	probably damaging	Het
Cyp4f40	T	C	17: 32,659,528	S15P	probably benign	Het
Ddx46	T	C	13: 55,663,914	S643P	probably damaging	Het
Defb34	A	G	8: 19,123,798	Q16R	probably null	Het
Dhrs2	T	A	14: 55,238,764	V147E	probably damaging	Het
Dnah5	G	T	15: 28,346,865	R2498L	probably damaging	Het
Dpp10	T	A	1: 123,854,172	I93F	probably benign	Het
Eef1e1	T	A	13: 38,655,069	D104V	probably damaging	Het
Egfr	A	G	11: 16,858,971	Y55C	probably damaging	Het
Egfr	A	C	11: 16,908,885	I955L	probably damaging	Het
Ehbp1l1	C	A	19: 5,719,998	V426F	possibly damaging	Het
Fam234a	C	T	17: 26,218,698	V108I	probably benign	Het
Fzd8	T	A	18: 9,214,688	M590K	probably damaging	Het
Gm13287	T	C	4: 88,803,638	S129P	probably damaging	Het
Heatr5b	A	G	17: 78,755,364	S1919P	possibly damaging	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Ikbkap	C	T	4: 56,772,491	E877K	probably damaging	Het
Itpr2	T	C	6: 146,328,398	E1233G	probably damaging	Het
Kcnmb4	A	G	10: 116,418,314	L186P	probably damaging	Het
Krt72	T	A	15: 101,782,145	Y224F	probably damaging	Het
Loxhd1	T	C	18: 77,339,579		probably null	Het
Lrguk	A	G	6: 34,102,571	T914A	probably benign	Het
Lrrtm4	A	G	6: 80,021,991	T129A	probably damaging	Het
Mmp13	A	T	9: 7,276,636	I244F	possibly damaging	Het
Mob1a	T	A	6: 83,329,974	L41Q	probably damaging	Het
Mtcl1	T	C	17: 66,436,217	R426G	probably damaging	Het
Mybbp1a	T	C	11: 72,445,288		probably null	Het
Myh9	A	G	15: 77,788,917		probably null	Het
Myo1d	T	A	11: 80,557,521	D926V	probably damaging	Het
Ncapg	T	G	5: 45,695,668	H825Q	probably damaging	Het
Olfml1	T	C	7: 107,590,363	S212P	probably benign	Het
Olfr656	G	A	7: 104,618,114	R145H	probably benign	Het
Pak2	T	C	16: 32,052,211	N51S	probably benign	Het
Papln	T	C	12: 83,786,619	Y1132H	probably damaging	Het
Pax3	T	A	1: 78,193,789	R134S	probably damaging	Het
Pdzrn4	A	G	15: 92,770,937	E990G	probably damaging	Het
Peak1	A	T	9: 56,207,476	W1394R	probably damaging	Het
Pkn2	T	C	3: 142,829,010	N285D	probably benign	Het
Pramef12	A	C	4: 144,395,857	L39R	probably damaging	Het
Prrc2a	A	G	17: 35,156,984	S897P	possibly damaging	Het
Rad51	A	G	2: 119,123,831	T131A	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rictor	T	A	15: 6,745,562	V125E	probably damaging	Het
Rps6ka5	C	T	12: 100,558,487	D664N	possibly damaging	Het
Rreb1	T	A	13: 37,947,621	W1584R	probably damaging	Het
Rxra	T	C	2: 27,741,183	I142T	probably damaging	Het
Sall2	T	C	14: 52,312,886	T951A	probably benign	Het
Slc15a2	T	G	16: 36,759,307	N359T	probably damaging	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Slc6a13	T	C	6: 121,337,414	*603Q	probably null	Het
Sptb	T	C	12: 76,619,162	D894G	possibly damaging	Het
Srgn	A	G	10: 62,507,665	L17P	probably damaging	Het
Tmprss9	T	C	10: 80,897,371		probably null	Het
Trav9n-4	T	C	14: 53,294,946	F86L	probably benign	Het
Trp63	A	G	16: 25,876,734	Y482C	unknown	Het
Ttc9b	G	T	7: 27,653,969	A15S	probably damaging	Het
Urb1	A	T	16: 90,791,190	I410N	probably damaging	Het
Vmn2r82	A	T	10: 79,378,893	K237*	probably null	Het
Wwox	G	A	8: 114,489,005		probably null	Het

Other mutations in Rc3h2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Rc3h2	APN	2	37389747	missense	possibly damaging	0.59
IGL00944:Rc3h2	APN	2	37398238	splice site	probably benign
IGL01065:Rc3h2	APN	2	37377844	splice site	probably benign
IGL01966:Rc3h2	APN	2	37382777	splice site	probably benign
IGL02123:Rc3h2	APN	2	37398253	missense	probably damaging	1.00
IGL02174:Rc3h2	APN	2	37411225	missense	probably benign	0.11
IGL02448:Rc3h2	APN	2	37389805	missense	probably benign	0.08
IGL02539:Rc3h2	APN	2	37389715	missense	probably benign	0.09
IGL02698:Rc3h2	APN	2	37405300	missense	probably damaging	0.99
IGL02731:Rc3h2	APN	2	37382811	missense	probably benign	0.00
IGL02958:Rc3h2	APN	2	37414700	missense	probably damaging	1.00
IGL02959:Rc3h2	APN	2	37405354	missense	probably damaging	1.00
PIT4468001:Rc3h2	UTSW	2	37399639	missense	probably damaging	1.00
R0309:Rc3h2	UTSW	2	37379008	splice site	probably benign
R0488:Rc3h2	UTSW	2	37389588	missense	probably damaging	0.99
R0506:Rc3h2	UTSW	2	37376659	critical splice donor site	probably null
R0612:Rc3h2	UTSW	2	37411215	missense	possibly damaging	0.77
R0628:Rc3h2	UTSW	2	37382052	splice site	probably benign
R0647:Rc3h2	UTSW	2	37409530	missense	probably damaging	1.00
R0680:Rc3h2	UTSW	2	37399835	missense	probably damaging	0.97
R0738:Rc3h2	UTSW	2	37405374	missense	probably damaging	1.00
R2005:Rc3h2	UTSW	2	37389753	nonsense	probably null
R2105:Rc3h2	UTSW	2	37399624	missense	possibly damaging	0.89
R2133:Rc3h2	UTSW	2	37378916	missense	probably benign	0.12
R2373:Rc3h2	UTSW	2	37379001	missense	possibly damaging	0.94
R2414:Rc3h2	UTSW	2	37399819	critical splice donor site	probably null
R2850:Rc3h2	UTSW	2	37377415	missense	probably benign
R2913:Rc3h2	UTSW	2	37378959	missense	possibly damaging	0.89
R2932:Rc3h2	UTSW	2	37378359	missense	probably benign	0.10
R4441:Rc3h2	UTSW	2	37414514	critical splice donor site	probably null
R4932:Rc3h2	UTSW	2	37389832	missense	possibly damaging	0.77
R5114:Rc3h2	UTSW	2	37398361	splice site	probably null
R5169:Rc3h2	UTSW	2	37405312	missense	probably damaging	1.00
R5360:Rc3h2	UTSW	2	37389855	missense	possibly damaging	0.59
R5477:Rc3h2	UTSW	2	37399630	missense	possibly damaging	0.94
R5553:Rc3h2	UTSW	2	37398311	nonsense	probably null
R5776:Rc3h2	UTSW	2	37378313	missense	possibly damaging	0.59
R5842:Rc3h2	UTSW	2	37378371	missense	possibly damaging	0.77
R5935:Rc3h2	UTSW	2	37414733	frame shift	probably null
R6060:Rc3h2	UTSW	2	37399600	missense	possibly damaging	0.77
R6112:Rc3h2	UTSW	2	37378887	missense	possibly damaging	0.59
R6172:Rc3h2	UTSW	2	37414733	frame shift	probably null
R6173:Rc3h2	UTSW	2	37414733	frame shift	probably null
R6177:Rc3h2	UTSW	2	37389646	missense	probably benign	0.02
R6455:Rc3h2	UTSW	2	37409470	missense	probably damaging	1.00
R6457:Rc3h2	UTSW	2	37411139	critical splice donor site	probably null
R6467:Rc3h2	UTSW	2	37382016	missense	probably damaging	0.97
R6647:Rc3h2	UTSW	2	37382944	nonsense	probably null
R6694:Rc3h2	UTSW	2	37400543	missense	probably damaging	1.00
R6695:Rc3h2	UTSW	2	37414661	missense	possibly damaging	0.88
R7054:Rc3h2	UTSW	2	37375246	missense	probably benign	0.07
R7159:Rc3h2	UTSW	2	37409647	missense	probably benign	0.39
R7162:Rc3h2	UTSW	2	37409605	missense	possibly damaging	0.59
R7640:Rc3h2	UTSW	2	37377849	critical splice donor site	probably null
R7676:Rc3h2	UTSW	2	37405332	missense	possibly damaging	0.95
R8209:Rc3h2	UTSW	2	37376989	missense	possibly damaging	0.77
R8226:Rc3h2	UTSW	2	37376989	missense	possibly damaging	0.77
R8528:Rc3h2	UTSW	2	37382799	missense	probably benign	0.05
R8836:Rc3h2	UTSW	2	37377929	missense	possibly damaging	0.59
R8957:Rc3h2	UTSW	2	37399648	missense	possibly damaging	0.59
R9053:Rc3h2	UTSW	2	37399616	missense	possibly damaging	0.95
R9131:Rc3h2	UTSW	2	37414690	missense	possibly damaging	0.94
R9178:Rc3h2	UTSW	2	37405252	missense	possibly damaging	0.77
R9437:Rc3h2	UTSW	2	37382829	missense	possibly damaging	0.94
X0013:Rc3h2	UTSW	2	37389786	missense	possibly damaging	0.60
Z1187:Rc3h2	UTSW	2	37399600	missense	possibly damaging	0.77
Z1188:Rc3h2	UTSW	2	37399600	missense	possibly damaging	0.77
Z1189:Rc3h2	UTSW	2	37409556	missense	possibly damaging	0.94
Z1192:Rc3h2	UTSW	2	37399600	missense	possibly damaging	0.77
Z1192:Rc3h2	UTSW	2	37409556	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TTTATGAGCCAAGTCCCCATACAG -3'
(R):5'- TCCTGCCAAATGCTGATGAACTC -3'

Sequencing Primer
(F):5'- GTCCCCATACAGCAGTGAAG -3'
(R):5'- CTGGTATATAACCCCTTCAGC -3'

Posted On

2020-09-02