Incidental Mutation 'R8324:Pkn2'
ID 643971
Institutional Source Beutler Lab
Gene Symbol Pkn2
Ensembl Gene ENSMUSG00000004591
Gene Name protein kinase N2
Synonyms Stk7, PRK2, Prkcl2, 6030436C20Rik
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 142496663-142587765 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 142534771 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 285 (N285D)
Ref Sequence ENSEMBL: ENSMUSP00000039566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043812] [ENSMUST00000173830] [ENSMUST00000173913] [ENSMUST00000174422]
AlphaFold Q8BWW9
Predicted Effect probably benign
Transcript: ENSMUST00000043812
AA Change: N285D

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000039566
Gene: ENSMUSG00000004591
AA Change: N285D

DomainStartEndE-ValueType
Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
C2 329 462 2.72e-8 SMART
low complexity region 535 546 N/A INTRINSIC
low complexity region 570 578 N/A INTRINSIC
S_TKc 656 915 7.94e-100 SMART
S_TK_X 916 980 6.77e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173830
AA Change: N285D

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133691
Gene: ENSMUSG00000004591
AA Change: N285D

DomainStartEndE-ValueType
Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
low complexity region 364 380 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 522 530 N/A INTRINSIC
S_TKc 608 867 7.94e-100 SMART
S_TK_X 868 932 6.77e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173913
Predicted Effect probably benign
Transcript: ENSMUST00000174422
AA Change: N285D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134559
Gene: ENSMUSG00000004591
AA Change: N285D

DomainStartEndE-ValueType
Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
C2 329 446 2.92e-8 SMART
low complexity region 519 530 N/A INTRINSIC
low complexity region 554 562 N/A INTRINSIC
S_TKc 640 899 7.94e-100 SMART
S_TK_X 900 964 6.77e-16 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000134041
Gene: ENSMUSG00000004591
AA Change: N66D

DomainStartEndE-ValueType
Hr1 1 67 1.33e-18 SMART
C2 72 182 3.51e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality during organogenesis with impaired mesenchymal cell proliferation and neural crest cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Pkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Pkn2 APN 3 142,504,780 (GRCm39) missense probably damaging 1.00
IGL00852:Pkn2 APN 3 142,515,577 (GRCm39) unclassified probably benign
IGL00917:Pkn2 APN 3 142,559,386 (GRCm39) missense probably damaging 1.00
IGL01147:Pkn2 APN 3 142,534,770 (GRCm39) missense probably benign 0.06
IGL01556:Pkn2 APN 3 142,535,078 (GRCm39) missense possibly damaging 0.88
IGL01574:Pkn2 APN 3 142,544,992 (GRCm39) missense possibly damaging 0.48
IGL02058:Pkn2 APN 3 142,509,424 (GRCm39) missense probably damaging 0.97
IGL02136:Pkn2 APN 3 142,559,351 (GRCm39) missense probably damaging 1.00
IGL02310:Pkn2 APN 3 142,517,341 (GRCm39) missense probably damaging 1.00
IGL02540:Pkn2 APN 3 142,515,465 (GRCm39) missense probably benign 0.01
IGL02607:Pkn2 APN 3 142,499,862 (GRCm39) critical splice donor site probably null
IGL03256:Pkn2 APN 3 142,509,311 (GRCm39) splice site probably null
voodoo UTSW 3 142,559,299 (GRCm39) missense possibly damaging 0.78
R0001:Pkn2 UTSW 3 142,534,749 (GRCm39) missense probably benign 0.00
R0048:Pkn2 UTSW 3 142,516,588 (GRCm39) missense probably damaging 1.00
R0081:Pkn2 UTSW 3 142,559,343 (GRCm39) missense probably damaging 1.00
R0514:Pkn2 UTSW 3 142,516,219 (GRCm39) missense possibly damaging 0.76
R0670:Pkn2 UTSW 3 142,545,104 (GRCm39) missense probably damaging 0.99
R0709:Pkn2 UTSW 3 142,536,281 (GRCm39) missense probably damaging 0.98
R1025:Pkn2 UTSW 3 142,527,326 (GRCm39) critical splice donor site probably null
R1190:Pkn2 UTSW 3 142,517,286 (GRCm39) critical splice donor site probably null
R1602:Pkn2 UTSW 3 142,559,299 (GRCm39) missense possibly damaging 0.78
R1729:Pkn2 UTSW 3 142,516,462 (GRCm39) missense probably benign 0.00
R1756:Pkn2 UTSW 3 142,516,488 (GRCm39) missense possibly damaging 0.94
R1764:Pkn2 UTSW 3 142,499,615 (GRCm39) missense probably damaging 1.00
R1797:Pkn2 UTSW 3 142,515,289 (GRCm39) missense probably damaging 1.00
R1833:Pkn2 UTSW 3 142,527,408 (GRCm39) missense probably damaging 1.00
R2035:Pkn2 UTSW 3 142,526,348 (GRCm39) missense probably damaging 0.99
R2058:Pkn2 UTSW 3 142,559,232 (GRCm39) missense possibly damaging 0.93
R3779:Pkn2 UTSW 3 142,499,741 (GRCm39) missense possibly damaging 0.89
R3940:Pkn2 UTSW 3 142,499,672 (GRCm39) missense probably damaging 1.00
R3967:Pkn2 UTSW 3 142,515,438 (GRCm39) missense probably damaging 0.98
R4008:Pkn2 UTSW 3 142,516,219 (GRCm39) missense possibly damaging 0.76
R4160:Pkn2 UTSW 3 142,509,325 (GRCm39) missense probably benign 0.42
R4222:Pkn2 UTSW 3 142,499,627 (GRCm39) nonsense probably null
R4243:Pkn2 UTSW 3 142,526,339 (GRCm39) missense possibly damaging 0.64
R4380:Pkn2 UTSW 3 142,536,217 (GRCm39) unclassified probably benign
R4826:Pkn2 UTSW 3 142,515,270 (GRCm39) missense probably damaging 1.00
R4869:Pkn2 UTSW 3 142,509,379 (GRCm39) missense probably damaging 1.00
R5096:Pkn2 UTSW 3 142,545,092 (GRCm39) missense probably damaging 0.99
R5175:Pkn2 UTSW 3 142,504,684 (GRCm39) missense probably damaging 1.00
R5301:Pkn2 UTSW 3 142,544,967 (GRCm39) critical splice donor site probably null
R5839:Pkn2 UTSW 3 142,527,290 (GRCm39) missense probably benign 0.02
R6155:Pkn2 UTSW 3 142,559,454 (GRCm39) missense probably benign 0.00
R6198:Pkn2 UTSW 3 142,516,165 (GRCm39) missense probably benign 0.00
R6255:Pkn2 UTSW 3 142,517,360 (GRCm39) missense probably damaging 1.00
R6293:Pkn2 UTSW 3 142,515,465 (GRCm39) missense probably benign 0.15
R6494:Pkn2 UTSW 3 142,509,429 (GRCm39) missense possibly damaging 0.94
R6659:Pkn2 UTSW 3 142,509,348 (GRCm39) missense probably damaging 1.00
R6809:Pkn2 UTSW 3 142,504,765 (GRCm39) missense probably damaging 1.00
R7267:Pkn2 UTSW 3 142,517,776 (GRCm39) missense possibly damaging 0.90
R7367:Pkn2 UTSW 3 142,516,488 (GRCm39) missense probably benign 0.00
R7746:Pkn2 UTSW 3 142,499,868 (GRCm39) missense probably damaging 1.00
R7940:Pkn2 UTSW 3 142,516,480 (GRCm39) missense probably benign 0.00
R8847:Pkn2 UTSW 3 142,526,401 (GRCm39) missense probably benign 0.29
R8947:Pkn2 UTSW 3 142,517,674 (GRCm39) critical splice donor site probably null
R9096:Pkn2 UTSW 3 142,515,249 (GRCm39) missense probably benign 0.03
R9097:Pkn2 UTSW 3 142,515,249 (GRCm39) missense probably benign 0.03
R9130:Pkn2 UTSW 3 142,515,245 (GRCm39) missense possibly damaging 0.51
R9226:Pkn2 UTSW 3 142,499,709 (GRCm39) missense probably damaging 1.00
R9267:Pkn2 UTSW 3 142,517,676 (GRCm39) missense probably null 0.97
R9277:Pkn2 UTSW 3 142,516,509 (GRCm39) missense probably benign 0.01
R9308:Pkn2 UTSW 3 142,517,724 (GRCm39) missense probably benign 0.21
R9372:Pkn2 UTSW 3 142,535,018 (GRCm39) missense probably damaging 0.99
R9551:Pkn2 UTSW 3 142,499,594 (GRCm39) missense probably damaging 1.00
R9552:Pkn2 UTSW 3 142,499,594 (GRCm39) missense probably damaging 1.00
R9782:Pkn2 UTSW 3 142,516,237 (GRCm39) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CTGTACATATGCCTCTGACTCCAAC -3'
(R):5'- CAGACAGAAAAGCGCTTTCAG -3'

Sequencing Primer
(F):5'- ATGCCTCTGACTCCAACTATTAATC -3'
(R):5'- GCGCTTTCAGAAGTAATTTTAAAAAC -3'
Posted On 2020-09-02