Incidental Mutation 'R8324:Ikbkap'
ID 643972
Institutional Source Beutler Lab
Gene Symbol Ikbkap
Ensembl Gene ENSMUSG00000028431
Gene Name inhibitor of kappa light polypeptide enhancer in B cells, kinase complex-associated protein
Synonyms C78473, Elp1, IKAP, 3110040G09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 56749680-56802331 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 56772491 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 877 (E877K)
Ref Sequence ENSEMBL: ENSMUSP00000030140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030140]
AlphaFold Q7TT37
Predicted Effect probably damaging
Transcript: ENSMUST00000030140
AA Change: E877K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030140
Gene: ENSMUSG00000028431
AA Change: E877K

DomainStartEndE-ValueType
Pfam:IKI3 1 955 N/A PFAM
low complexity region 1186 1205 N/A INTRINSIC
low complexity region 1210 1225 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a scaffold protein and a regulator for three different kinases involved in proinflammatory signaling. The encoded protein can bind NF-kappa-B-inducing kinase and I-kappa-B kinases through separate domains and assemble them into an active kinase complex. Mutations in this gene have been associated with familial dysautonomia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with arrested neural and vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,290,395 S753P probably damaging Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Antxr2 T C 5: 97,938,509 N413S probably damaging Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
Caprin1 G A 2: 103,783,181 R79* probably null Het
Cdan1 A G 2: 120,727,325 V507A probably benign Het
Cdkl3 T A 11: 52,022,879 probably null Het
Chst5 A T 8: 111,890,508 L160Q probably benign Het
Col11a1 C G 3: 114,164,410 P1111R probably damaging Het
Col6a6 T A 9: 105,755,654 E1470D probably benign Het
Cpped1 T A 16: 11,805,476 T274S probably benign Het
Ctnnbl1 G A 2: 157,779,815 E75K probably damaging Het
Cyp4f40 T C 17: 32,659,528 S15P probably benign Het
Ddx46 T C 13: 55,663,914 S643P probably damaging Het
Defb34 A G 8: 19,123,798 Q16R probably null Het
Dhrs2 T A 14: 55,238,764 V147E probably damaging Het
Dnah5 G T 15: 28,346,865 R2498L probably damaging Het
Dpp10 T A 1: 123,854,172 I93F probably benign Het
Eef1e1 T A 13: 38,655,069 D104V probably damaging Het
Egfr A G 11: 16,858,971 Y55C probably damaging Het
Egfr A C 11: 16,908,885 I955L probably damaging Het
Ehbp1l1 C A 19: 5,719,998 V426F possibly damaging Het
Fam234a C T 17: 26,218,698 V108I probably benign Het
Fzd8 T A 18: 9,214,688 M590K probably damaging Het
Gm13287 T C 4: 88,803,638 S129P probably damaging Het
Heatr5b A G 17: 78,755,364 S1919P possibly damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Itpr2 T C 6: 146,328,398 E1233G probably damaging Het
Kcnmb4 A G 10: 116,418,314 L186P probably damaging Het
Krt72 T A 15: 101,782,145 Y224F probably damaging Het
Loxhd1 T C 18: 77,339,579 probably null Het
Lrguk A G 6: 34,102,571 T914A probably benign Het
Lrrtm4 A G 6: 80,021,991 T129A probably damaging Het
Mmp13 A T 9: 7,276,636 I244F possibly damaging Het
Mob1a T A 6: 83,329,974 L41Q probably damaging Het
Mtcl1 T C 17: 66,436,217 R426G probably damaging Het
Mybbp1a T C 11: 72,445,288 probably null Het
Myh9 A G 15: 77,788,917 probably null Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Ncapg T G 5: 45,695,668 H825Q probably damaging Het
Olfml1 T C 7: 107,590,363 S212P probably benign Het
Olfr656 G A 7: 104,618,114 R145H probably benign Het
Pak2 T C 16: 32,052,211 N51S probably benign Het
Papln T C 12: 83,786,619 Y1132H probably damaging Het
Pax3 T A 1: 78,193,789 R134S probably damaging Het
Pdzrn4 A G 15: 92,770,937 E990G probably damaging Het
Peak1 A T 9: 56,207,476 W1394R probably damaging Het
Pkn2 T C 3: 142,829,010 N285D probably benign Het
Pramef12 A C 4: 144,395,857 L39R probably damaging Het
Prrc2a A G 17: 35,156,984 S897P possibly damaging Het
Rad51 A G 2: 119,123,831 T131A possibly damaging Het
Rc3h2 T A 2: 37,400,726 T255S possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rictor T A 15: 6,745,562 V125E probably damaging Het
Rps6ka5 C T 12: 100,558,487 D664N possibly damaging Het
Rreb1 T A 13: 37,947,621 W1584R probably damaging Het
Rxra T C 2: 27,741,183 I142T probably damaging Het
Sall2 T C 14: 52,312,886 T951A probably benign Het
Slc15a2 T G 16: 36,759,307 N359T probably damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc6a13 T C 6: 121,337,414 *603Q probably null Het
Sptb T C 12: 76,619,162 D894G possibly damaging Het
Srgn A G 10: 62,507,665 L17P probably damaging Het
Tmprss9 T C 10: 80,897,371 probably null Het
Trav9n-4 T C 14: 53,294,946 F86L probably benign Het
Trp63 A G 16: 25,876,734 Y482C unknown Het
Ttc9b G T 7: 27,653,969 A15S probably damaging Het
Urb1 A T 16: 90,791,190 I410N probably damaging Het
Vmn2r82 A T 10: 79,378,893 K237* probably null Het
Wwox G A 8: 114,489,005 probably null Het
Other mutations in Ikbkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ikbkap APN 4 56784537 critical splice donor site probably null
IGL01521:Ikbkap APN 4 56771059 missense probably benign 0.27
IGL02069:Ikbkap APN 4 56779731 missense probably benign 0.31
IGL02162:Ikbkap APN 4 56796502 critical splice donor site probably null
IGL02252:Ikbkap APN 4 56759813 missense probably benign 0.09
IGL02726:Ikbkap APN 4 56767878 critical splice acceptor site probably null
IGL02822:Ikbkap APN 4 56774520 critical splice donor site probably null
IGL03024:Ikbkap APN 4 56774686 critical splice donor site probably null
IGL03126:Ikbkap APN 4 56779717 missense probably benign
R0211:Ikbkap UTSW 4 56795545 missense probably damaging 1.00
R0239:Ikbkap UTSW 4 56784596 missense probably benign 0.00
R0239:Ikbkap UTSW 4 56784596 missense probably benign 0.00
R0603:Ikbkap UTSW 4 56792105 missense possibly damaging 0.94
R1109:Ikbkap UTSW 4 56786723 missense probably benign 0.00
R1314:Ikbkap UTSW 4 56786647 missense probably benign 0.00
R1333:Ikbkap UTSW 4 56770969 splice site probably benign
R1434:Ikbkap UTSW 4 56781193 missense probably benign 0.02
R1547:Ikbkap UTSW 4 56792090 missense probably damaging 1.00
R1547:Ikbkap UTSW 4 56798810 missense probably damaging 1.00
R1587:Ikbkap UTSW 4 56786666 nonsense probably null
R1601:Ikbkap UTSW 4 56774756 nonsense probably null
R2076:Ikbkap UTSW 4 56786620 missense probably damaging 0.98
R2153:Ikbkap UTSW 4 56779636 splice site probably null
R2263:Ikbkap UTSW 4 56755298 splice site probably null
R2325:Ikbkap UTSW 4 56784622 missense probably benign 0.00
R2333:Ikbkap UTSW 4 56775456 missense probably benign 0.28
R3151:Ikbkap UTSW 4 56770985 missense probably benign 0.24
R3622:Ikbkap UTSW 4 56759925 splice site probably null
R3624:Ikbkap UTSW 4 56798708 missense possibly damaging 0.52
R3889:Ikbkap UTSW 4 56759852 missense probably damaging 1.00
R4007:Ikbkap UTSW 4 56794139 missense probably damaging 1.00
R4196:Ikbkap UTSW 4 56755353 missense probably damaging 1.00
R4794:Ikbkap UTSW 4 56781176 small deletion probably benign
R5330:Ikbkap UTSW 4 56800001 missense probably benign 0.01
R5331:Ikbkap UTSW 4 56800001 missense probably benign 0.01
R5360:Ikbkap UTSW 4 56800104 missense probably benign 0.06
R5362:Ikbkap UTSW 4 56778969 missense probably damaging 0.99
R5645:Ikbkap UTSW 4 56776920 missense possibly damaging 0.93
R5877:Ikbkap UTSW 4 56787807 missense probably damaging 1.00
R6268:Ikbkap UTSW 4 56762305 missense probably damaging 1.00
R6284:Ikbkap UTSW 4 56762281 missense probably damaging 0.99
R6526:Ikbkap UTSW 4 56798812 critical splice acceptor site probably null
R6610:Ikbkap UTSW 4 56758236 missense probably benign 0.02
R6627:Ikbkap UTSW 4 56784647 splice site probably null
R6786:Ikbkap UTSW 4 56771555 missense possibly damaging 0.80
R6823:Ikbkap UTSW 4 56787939 missense probably damaging 1.00
R7129:Ikbkap UTSW 4 56787944 missense probably damaging 1.00
R7157:Ikbkap UTSW 4 56781176 small deletion probably benign
R7180:Ikbkap UTSW 4 56796535 missense probably damaging 1.00
R7391:Ikbkap UTSW 4 56781211 missense possibly damaging 0.82
R7391:Ikbkap UTSW 4 56781212 missense probably benign 0.00
R7403:Ikbkap UTSW 4 56778994 missense probably damaging 1.00
R7432:Ikbkap UTSW 4 56776925 missense probably damaging 1.00
R7674:Ikbkap UTSW 4 56792075 missense probably damaging 0.97
R7736:Ikbkap UTSW 4 56776920 missense possibly damaging 0.93
R7755:Ikbkap UTSW 4 56774552 missense possibly damaging 0.80
R7760:Ikbkap UTSW 4 56790892 missense probably benign 0.20
R7849:Ikbkap UTSW 4 56758968 missense possibly damaging 0.65
R7959:Ikbkap UTSW 4 56774737 missense probably damaging 1.00
R7970:Ikbkap UTSW 4 56771466 missense probably damaging 1.00
R8456:Ikbkap UTSW 4 56781176 small deletion probably benign
R8671:Ikbkap UTSW 4 56771453 missense probably damaging 1.00
R9245:Ikbkap UTSW 4 56771003 missense probably benign 0.01
R9562:Ikbkap UTSW 4 56772521 missense probably benign 0.00
R9565:Ikbkap UTSW 4 56772521 missense probably benign 0.00
R9568:Ikbkap UTSW 4 56786711 missense probably damaging 1.00
Z1176:Ikbkap UTSW 4 56790146 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAGACTCAGATCTGCATCC -3'
(R):5'- TCCAAGTGACTCTGTTCTGATGG -3'

Sequencing Primer
(F):5'- GGAGACTCAGATCTGCATCCACTTG -3'
(R):5'- GGCCTCAGACTCACTATGTAGCTAG -3'
Posted On 2020-09-02