Incidental Mutation 'R8324:Gm13287'
ID 643973
Institutional Source Beutler Lab
Gene Symbol Gm13287
Ensembl Gene ENSMUSG00000094648
Gene Name predicted gene 13287
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock # R8324 (G1)
Quality Score 124.008
Status Not validated
Chromosome 4
Chromosomal Location 88803254-88803802 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88803638 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 129 (S129P)
Ref Sequence ENSEMBL: ENSMUSP00000136234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094977] [ENSMUST00000179490] [ENSMUST00000179725]
AlphaFold B1AYI3
Predicted Effect probably benign
Transcript: ENSMUST00000094977
SMART Domains Protein: ENSMUSP00000092585
Gene: ENSMUSG00000070908

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IFabd 58 170 3.12e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179490
AA Change: S129P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136234
Gene: ENSMUSG00000094648
AA Change: S129P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IFabd 58 170 2.91e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179725
SMART Domains Protein: ENSMUSP00000137222
Gene: ENSMUSG00000095101

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IFabd 58 170 2.91e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,290,395 S753P probably damaging Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Antxr2 T C 5: 97,938,509 N413S probably damaging Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
Caprin1 G A 2: 103,783,181 R79* probably null Het
Cdan1 A G 2: 120,727,325 V507A probably benign Het
Cdkl3 T A 11: 52,022,879 probably null Het
Chst5 A T 8: 111,890,508 L160Q probably benign Het
Col11a1 C G 3: 114,164,410 P1111R probably damaging Het
Col6a6 T A 9: 105,755,654 E1470D probably benign Het
Cpped1 T A 16: 11,805,476 T274S probably benign Het
Ctnnbl1 G A 2: 157,779,815 E75K probably damaging Het
Cyp4f40 T C 17: 32,659,528 S15P probably benign Het
Ddx46 T C 13: 55,663,914 S643P probably damaging Het
Defb34 A G 8: 19,123,798 Q16R probably null Het
Dhrs2 T A 14: 55,238,764 V147E probably damaging Het
Dnah5 G T 15: 28,346,865 R2498L probably damaging Het
Dpp10 T A 1: 123,854,172 I93F probably benign Het
Eef1e1 T A 13: 38,655,069 D104V probably damaging Het
Egfr A G 11: 16,858,971 Y55C probably damaging Het
Egfr A C 11: 16,908,885 I955L probably damaging Het
Ehbp1l1 C A 19: 5,719,998 V426F possibly damaging Het
Fam234a C T 17: 26,218,698 V108I probably benign Het
Fzd8 T A 18: 9,214,688 M590K probably damaging Het
Heatr5b A G 17: 78,755,364 S1919P possibly damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ikbkap C T 4: 56,772,491 E877K probably damaging Het
Itpr2 T C 6: 146,328,398 E1233G probably damaging Het
Kcnmb4 A G 10: 116,418,314 L186P probably damaging Het
Krt72 T A 15: 101,782,145 Y224F probably damaging Het
Loxhd1 T C 18: 77,339,579 probably null Het
Lrguk A G 6: 34,102,571 T914A probably benign Het
Lrrtm4 A G 6: 80,021,991 T129A probably damaging Het
Mmp13 A T 9: 7,276,636 I244F possibly damaging Het
Mob1a T A 6: 83,329,974 L41Q probably damaging Het
Mtcl1 T C 17: 66,436,217 R426G probably damaging Het
Mybbp1a T C 11: 72,445,288 probably null Het
Myh9 A G 15: 77,788,917 probably null Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Ncapg T G 5: 45,695,668 H825Q probably damaging Het
Olfml1 T C 7: 107,590,363 S212P probably benign Het
Olfr656 G A 7: 104,618,114 R145H probably benign Het
Pak2 T C 16: 32,052,211 N51S probably benign Het
Papln T C 12: 83,786,619 Y1132H probably damaging Het
Pax3 T A 1: 78,193,789 R134S probably damaging Het
Pdzrn4 A G 15: 92,770,937 E990G probably damaging Het
Peak1 A T 9: 56,207,476 W1394R probably damaging Het
Pkn2 T C 3: 142,829,010 N285D probably benign Het
Pramef12 A C 4: 144,395,857 L39R probably damaging Het
Prrc2a A G 17: 35,156,984 S897P possibly damaging Het
Rad51 A G 2: 119,123,831 T131A possibly damaging Het
Rc3h2 T A 2: 37,400,726 T255S possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rictor T A 15: 6,745,562 V125E probably damaging Het
Rps6ka5 C T 12: 100,558,487 D664N possibly damaging Het
Rreb1 T A 13: 37,947,621 W1584R probably damaging Het
Rxra T C 2: 27,741,183 I142T probably damaging Het
Sall2 T C 14: 52,312,886 T951A probably benign Het
Slc15a2 T G 16: 36,759,307 N359T probably damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc6a13 T C 6: 121,337,414 *603Q probably null Het
Sptb T C 12: 76,619,162 D894G possibly damaging Het
Srgn A G 10: 62,507,665 L17P probably damaging Het
Tmprss9 T C 10: 80,897,371 probably null Het
Trav9n-4 T C 14: 53,294,946 F86L probably benign Het
Trp63 A G 16: 25,876,734 Y482C unknown Het
Ttc9b G T 7: 27,653,969 A15S probably damaging Het
Urb1 A T 16: 90,791,190 I410N probably damaging Het
Vmn2r82 A T 10: 79,378,893 K237* probably null Het
Wwox G A 8: 114,489,005 probably null Het
Predicted Primers PCR Primer
(F):5'- TGTCCCTGGAAGGAAGGAAC -3'
(R):5'- ACGAGAGCAGAGAGATTCCTGC -3'

Sequencing Primer
(F):5'- TCCCTGGAAGGAAGGAACTAACATC -3'
(R):5'- CAGAGAGATTCCTGCACGGG -3'
Posted On 2020-09-02