Incidental Mutation 'R8324:Hspg2'
ID 643974
Institutional Source Beutler Lab
Gene Symbol Hspg2
Ensembl Gene ENSMUSG00000028763
Gene Name perlecan (heparan sulfate proteoglycan 2)
Synonyms Plc, per, perlecan, Pcn
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 137196080-137297941 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 137246290 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Alanine at position 1023 (P1023A)
Ref Sequence ENSEMBL: ENSMUSP00000131316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030547
AA Change: P1023A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763
AA Change: P1023A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1113 1156 7.5e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2056 2117 4.81e-15 SMART
IGc2 2157 2216 1.37e-10 SMART
IGc2 2251 2312 5.88e-10 SMART
low complexity region 2333 2344 N/A INTRINSIC
IGc2 2347 2408 1.97e-11 SMART
IGc2 2441 2502 1.59e-15 SMART
low complexity region 2517 2528 N/A INTRINSIC
IGc2 2538 2599 3.08e-13 SMART
IGc2 2634 2695 9.25e-17 SMART
low complexity region 2704 2728 N/A INTRINSIC
IGc2 2731 2792 1.84e-11 SMART
IGc2 2828 2889 2.11e-11 SMART
IGc2 2926 2987 3.25e-12 SMART
IG 3017 3098 3.62e-10 SMART
IGc2 3114 3180 9.05e-11 SMART
IGc2 3212 3273 2.44e-16 SMART
IGc2 3299 3360 2.26e-11 SMART
IGc2 3400 3461 6.81e-6 SMART
IGc2 3489 3550 1.59e-15 SMART
IGc2 3575 3636 2.54e-14 SMART
LamG 3672 3813 3.41e-39 SMART
EGF 3832 3866 6.91e-9 SMART
EGF 3872 3907 4.46e-3 SMART
LamG 3934 4070 4.78e-43 SMART
EGF 4092 4126 1.17e-6 SMART
EGF 4131 4161 1.87e-5 SMART
LamG 4211 4348 1.33e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171332
AA Change: P1023A

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763
AA Change: P1023A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1114 1156 7.9e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2062 2123 4.81e-15 SMART
IGc2 2163 2222 1.37e-10 SMART
IGc2 2257 2318 5.88e-10 SMART
low complexity region 2339 2350 N/A INTRINSIC
IGc2 2353 2414 1.97e-11 SMART
IGc2 2447 2508 1.59e-15 SMART
low complexity region 2523 2534 N/A INTRINSIC
IGc2 2544 2605 3.08e-13 SMART
IGc2 2640 2701 9.25e-17 SMART
low complexity region 2710 2734 N/A INTRINSIC
IGc2 2737 2798 1.84e-11 SMART
IGc2 2836 2897 2.11e-11 SMART
IGc2 2934 2995 3.25e-12 SMART
IG 3025 3106 3.62e-10 SMART
IGc2 3122 3188 9.05e-11 SMART
IGc2 3220 3281 2.44e-16 SMART
IGc2 3307 3368 2.26e-11 SMART
IGc2 3408 3469 6.81e-6 SMART
IGc2 3497 3558 1.59e-15 SMART
IGc2 3583 3644 2.54e-14 SMART
LamG 3680 3821 3.41e-39 SMART
EGF 3840 3874 6.91e-9 SMART
EGF 3880 3915 4.46e-3 SMART
LamG 3942 4078 4.78e-43 SMART
EGF 4100 4134 1.17e-6 SMART
EGF 4139 4169 1.87e-5 SMART
LamG 4219 4356 1.33e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Hspg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hspg2 APN 4 137,256,131 (GRCm39) missense probably damaging 1.00
IGL00339:Hspg2 APN 4 137,266,506 (GRCm39) missense probably damaging 1.00
IGL00943:Hspg2 APN 4 137,289,512 (GRCm39) missense probably benign 0.15
IGL00970:Hspg2 APN 4 137,269,901 (GRCm39) missense probably benign 0.09
IGL01011:Hspg2 APN 4 137,286,646 (GRCm39) missense probably damaging 1.00
IGL01148:Hspg2 APN 4 137,273,969 (GRCm39) missense probably benign 0.11
IGL01333:Hspg2 APN 4 137,267,625 (GRCm39) missense probably damaging 1.00
IGL01367:Hspg2 APN 4 137,265,800 (GRCm39) missense probably damaging 1.00
IGL01455:Hspg2 APN 4 137,281,128 (GRCm39) missense probably damaging 1.00
IGL01540:Hspg2 APN 4 137,247,017 (GRCm39) missense probably damaging 1.00
IGL01578:Hspg2 APN 4 137,266,494 (GRCm39) missense probably damaging 1.00
IGL01603:Hspg2 APN 4 137,280,114 (GRCm39) missense probably damaging 1.00
IGL01632:Hspg2 APN 4 137,242,084 (GRCm39) missense probably damaging 1.00
IGL01658:Hspg2 APN 4 137,292,237 (GRCm39) missense probably damaging 1.00
IGL01760:Hspg2 APN 4 137,239,982 (GRCm39) missense possibly damaging 0.60
IGL01976:Hspg2 APN 4 137,289,237 (GRCm39) missense probably damaging 1.00
IGL02024:Hspg2 APN 4 137,267,384 (GRCm39) missense probably damaging 1.00
IGL02033:Hspg2 APN 4 137,279,565 (GRCm39) missense probably benign
IGL02051:Hspg2 APN 4 137,295,700 (GRCm39) unclassified probably benign
IGL02124:Hspg2 APN 4 137,246,125 (GRCm39) splice site probably null
IGL02128:Hspg2 APN 4 137,291,327 (GRCm39) missense probably damaging 1.00
IGL02177:Hspg2 APN 4 137,242,627 (GRCm39) missense probably damaging 1.00
IGL02230:Hspg2 APN 4 137,245,956 (GRCm39) missense probably damaging 1.00
IGL02266:Hspg2 APN 4 137,237,888 (GRCm39) missense probably damaging 1.00
IGL02313:Hspg2 APN 4 137,235,700 (GRCm39) missense probably benign 0.03
IGL02477:Hspg2 APN 4 137,271,823 (GRCm39) splice site probably benign
IGL02514:Hspg2 APN 4 137,296,887 (GRCm39) missense probably benign 0.09
IGL02613:Hspg2 APN 4 137,271,731 (GRCm39) missense probably damaging 1.00
IGL02625:Hspg2 APN 4 137,239,953 (GRCm39) missense probably damaging 1.00
IGL02646:Hspg2 APN 4 137,279,159 (GRCm39) missense possibly damaging 0.60
IGL02651:Hspg2 APN 4 137,284,756 (GRCm39) splice site probably benign
IGL02701:Hspg2 APN 4 137,284,485 (GRCm39) missense probably damaging 0.96
IGL02833:Hspg2 APN 4 137,282,441 (GRCm39) missense probably benign 0.00
IGL02985:Hspg2 APN 4 137,235,114 (GRCm39) missense probably damaging 1.00
IGL03040:Hspg2 APN 4 137,289,136 (GRCm39) critical splice donor site probably null
IGL03181:Hspg2 APN 4 137,243,248 (GRCm39) missense probably damaging 1.00
IGL03349:Hspg2 APN 4 137,287,833 (GRCm39) splice site probably benign
G1patch:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
PIT4305001:Hspg2 UTSW 4 137,277,684 (GRCm39) missense possibly damaging 0.55
R0006:Hspg2 UTSW 4 137,247,242 (GRCm39) missense probably damaging 1.00
R0036:Hspg2 UTSW 4 137,270,160 (GRCm39) missense probably damaging 1.00
R0109:Hspg2 UTSW 4 137,289,512 (GRCm39) missense probably benign 0.15
R0131:Hspg2 UTSW 4 137,279,198 (GRCm39) missense probably damaging 1.00
R0131:Hspg2 UTSW 4 137,279,198 (GRCm39) missense probably damaging 1.00
R0132:Hspg2 UTSW 4 137,279,198 (GRCm39) missense probably damaging 1.00
R0245:Hspg2 UTSW 4 137,242,033 (GRCm39) missense probably damaging 1.00
R0388:Hspg2 UTSW 4 137,238,469 (GRCm39) missense probably damaging 1.00
R0389:Hspg2 UTSW 4 137,242,734 (GRCm39) missense possibly damaging 0.53
R0468:Hspg2 UTSW 4 137,260,840 (GRCm39) missense probably damaging 1.00
R0480:Hspg2 UTSW 4 137,277,335 (GRCm39) missense probably damaging 1.00
R0546:Hspg2 UTSW 4 137,229,605 (GRCm39) missense probably benign
R0599:Hspg2 UTSW 4 137,239,712 (GRCm39) missense probably damaging 0.98
R0652:Hspg2 UTSW 4 137,242,033 (GRCm39) missense probably damaging 1.00
R0671:Hspg2 UTSW 4 137,280,591 (GRCm39) missense probably damaging 1.00
R0760:Hspg2 UTSW 4 137,239,660 (GRCm39) missense probably damaging 1.00
R0883:Hspg2 UTSW 4 137,268,751 (GRCm39) missense probably benign 0.00
R1403:Hspg2 UTSW 4 137,267,411 (GRCm39) missense possibly damaging 0.90
R1417:Hspg2 UTSW 4 137,244,947 (GRCm39) missense probably benign
R1497:Hspg2 UTSW 4 137,275,407 (GRCm39) missense probably damaging 0.98
R1509:Hspg2 UTSW 4 137,238,552 (GRCm39) splice site probably benign
R1625:Hspg2 UTSW 4 137,246,282 (GRCm39) missense probably benign 0.23
R1630:Hspg2 UTSW 4 137,245,746 (GRCm39) missense probably damaging 1.00
R1651:Hspg2 UTSW 4 137,260,748 (GRCm39) nonsense probably null
R1699:Hspg2 UTSW 4 137,275,323 (GRCm39) splice site probably null
R1703:Hspg2 UTSW 4 137,286,462 (GRCm39) missense probably damaging 1.00
R1761:Hspg2 UTSW 4 137,241,984 (GRCm39) missense possibly damaging 0.90
R1775:Hspg2 UTSW 4 137,247,467 (GRCm39) missense probably damaging 0.99
R1779:Hspg2 UTSW 4 137,245,820 (GRCm39) missense probably damaging 1.00
R1843:Hspg2 UTSW 4 137,272,878 (GRCm39) missense probably damaging 1.00
R1891:Hspg2 UTSW 4 137,292,801 (GRCm39) missense probably damaging 1.00
R1930:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R1931:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R1942:Hspg2 UTSW 4 137,269,863 (GRCm39) missense possibly damaging 0.67
R1959:Hspg2 UTSW 4 137,292,206 (GRCm39) missense probably damaging 1.00
R2042:Hspg2 UTSW 4 137,295,677 (GRCm39) missense probably damaging 1.00
R2062:Hspg2 UTSW 4 137,286,678 (GRCm39) missense possibly damaging 0.79
R2098:Hspg2 UTSW 4 137,247,420 (GRCm39) missense probably damaging 1.00
R2158:Hspg2 UTSW 4 137,244,915 (GRCm39) missense probably damaging 1.00
R2280:Hspg2 UTSW 4 137,249,354 (GRCm39) missense probably damaging 1.00
R2890:Hspg2 UTSW 4 137,276,885 (GRCm39) missense probably damaging 1.00
R2927:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R3428:Hspg2 UTSW 4 137,282,601 (GRCm39) missense probably damaging 1.00
R3744:Hspg2 UTSW 4 137,292,815 (GRCm39) splice site probably benign
R3873:Hspg2 UTSW 4 137,266,660 (GRCm39) missense probably damaging 1.00
R3874:Hspg2 UTSW 4 137,266,660 (GRCm39) missense probably damaging 1.00
R3917:Hspg2 UTSW 4 137,286,625 (GRCm39) missense probably damaging 1.00
R3932:Hspg2 UTSW 4 137,242,879 (GRCm39) missense probably damaging 0.99
R3933:Hspg2 UTSW 4 137,242,879 (GRCm39) missense probably damaging 0.99
R4134:Hspg2 UTSW 4 137,283,968 (GRCm39) missense probably damaging 0.99
R4272:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4273:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4274:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4275:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4288:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4289:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4354:Hspg2 UTSW 4 137,196,222 (GRCm39) missense probably benign 0.17
R4355:Hspg2 UTSW 4 137,256,729 (GRCm39) missense probably damaging 0.98
R4400:Hspg2 UTSW 4 137,275,433 (GRCm39) missense probably benign 0.01
R4411:Hspg2 UTSW 4 137,289,535 (GRCm39) missense probably benign
R4421:Hspg2 UTSW 4 137,275,433 (GRCm39) missense probably benign 0.01
R4592:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137,266,886 (GRCm39) missense possibly damaging 0.80
R4612:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4619:Hspg2 UTSW 4 137,273,884 (GRCm39) missense probably damaging 1.00
R4658:Hspg2 UTSW 4 137,261,041 (GRCm39) missense probably damaging 1.00
R4667:Hspg2 UTSW 4 137,266,956 (GRCm39) missense possibly damaging 0.90
R4724:Hspg2 UTSW 4 137,249,438 (GRCm39) missense probably damaging 0.96
R4739:Hspg2 UTSW 4 137,297,384 (GRCm39) unclassified probably benign
R4793:Hspg2 UTSW 4 137,256,784 (GRCm39) missense possibly damaging 0.95
R4826:Hspg2 UTSW 4 137,292,706 (GRCm39) missense probably damaging 1.00
R4838:Hspg2 UTSW 4 137,268,977 (GRCm39) missense possibly damaging 0.53
R4896:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4926:Hspg2 UTSW 4 137,269,841 (GRCm39) missense probably damaging 1.00
R4939:Hspg2 UTSW 4 137,235,342 (GRCm39) missense probably damaging 1.00
R5032:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R5033:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R5071:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R5072:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R5114:Hspg2 UTSW 4 137,239,237 (GRCm39) missense probably damaging 1.00
R5177:Hspg2 UTSW 4 137,246,083 (GRCm39) missense probably damaging 1.00
R5223:Hspg2 UTSW 4 137,271,225 (GRCm39) missense probably damaging 1.00
R5433:Hspg2 UTSW 4 137,256,105 (GRCm39) splice site probably null
R5529:Hspg2 UTSW 4 137,279,139 (GRCm39) missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137,270,136 (GRCm39) missense probably benign 0.17
R5541:Hspg2 UTSW 4 137,247,862 (GRCm39) missense probably damaging 1.00
R5546:Hspg2 UTSW 4 137,275,485 (GRCm39) critical splice donor site probably null
R5728:Hspg2 UTSW 4 137,270,077 (GRCm39) missense possibly damaging 0.95
R5764:Hspg2 UTSW 4 137,289,032 (GRCm39) missense probably damaging 1.00
R5920:Hspg2 UTSW 4 137,281,093 (GRCm39) missense probably damaging 1.00
R5934:Hspg2 UTSW 4 137,246,083 (GRCm39) missense probably damaging 1.00
R6074:Hspg2 UTSW 4 137,268,046 (GRCm39) missense probably benign
R6164:Hspg2 UTSW 4 137,241,966 (GRCm39) missense possibly damaging 0.89
R6175:Hspg2 UTSW 4 137,296,829 (GRCm39) missense probably damaging 1.00
R6217:Hspg2 UTSW 4 137,267,559 (GRCm39) missense probably damaging 0.99
R6262:Hspg2 UTSW 4 137,246,997 (GRCm39) missense probably damaging 1.00
R6299:Hspg2 UTSW 4 137,272,016 (GRCm39) missense probably damaging 1.00
R6333:Hspg2 UTSW 4 137,289,266 (GRCm39) missense probably damaging 1.00
R6371:Hspg2 UTSW 4 137,269,006 (GRCm39) missense probably damaging 1.00
R6430:Hspg2 UTSW 4 137,266,707 (GRCm39) missense probably damaging 1.00
R6498:Hspg2 UTSW 4 137,235,112 (GRCm39) missense possibly damaging 0.46
R6522:Hspg2 UTSW 4 137,282,586 (GRCm39) missense probably damaging 1.00
R6680:Hspg2 UTSW 4 137,293,048 (GRCm39) missense probably benign 0.18
R6724:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
R6725:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
R6762:Hspg2 UTSW 4 137,279,114 (GRCm39) missense possibly damaging 0.83
R6785:Hspg2 UTSW 4 137,235,709 (GRCm39) missense probably damaging 0.99
R6788:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
R6931:Hspg2 UTSW 4 137,268,031 (GRCm39) missense probably damaging 1.00
R6959:Hspg2 UTSW 4 137,246,600 (GRCm39) missense probably benign 0.45
R6968:Hspg2 UTSW 4 137,262,467 (GRCm39) missense probably damaging 1.00
R6988:Hspg2 UTSW 4 137,256,201 (GRCm39) missense probably damaging 1.00
R7021:Hspg2 UTSW 4 137,269,580 (GRCm39) missense possibly damaging 0.69
R7089:Hspg2 UTSW 4 137,271,677 (GRCm39) missense possibly damaging 0.51
R7107:Hspg2 UTSW 4 137,237,963 (GRCm39) missense probably damaging 1.00
R7141:Hspg2 UTSW 4 137,279,427 (GRCm39) missense probably damaging 1.00
R7161:Hspg2 UTSW 4 137,242,030 (GRCm39) missense probably damaging 1.00
R7189:Hspg2 UTSW 4 137,260,872 (GRCm39) critical splice donor site probably null
R7238:Hspg2 UTSW 4 137,235,704 (GRCm39) missense probably damaging 1.00
R7253:Hspg2 UTSW 4 137,247,257 (GRCm39) missense probably benign 0.15
R7278:Hspg2 UTSW 4 137,278,436 (GRCm39) missense probably damaging 0.98
R7287:Hspg2 UTSW 4 137,256,867 (GRCm39) missense probably benign 0.00
R7390:Hspg2 UTSW 4 137,266,490 (GRCm39) missense probably damaging 1.00
R7436:Hspg2 UTSW 4 137,242,975 (GRCm39) missense probably damaging 0.99
R7479:Hspg2 UTSW 4 137,266,714 (GRCm39) missense probably benign 0.17
R7516:Hspg2 UTSW 4 137,269,931 (GRCm39) missense possibly damaging 0.94
R7540:Hspg2 UTSW 4 137,268,751 (GRCm39) missense possibly damaging 0.51
R7603:Hspg2 UTSW 4 137,284,503 (GRCm39) missense possibly damaging 0.91
R7603:Hspg2 UTSW 4 137,275,679 (GRCm39) missense probably damaging 1.00
R7625:Hspg2 UTSW 4 137,292,249 (GRCm39) missense probably damaging 1.00
R7696:Hspg2 UTSW 4 137,239,277 (GRCm39) missense possibly damaging 0.78
R7767:Hspg2 UTSW 4 137,239,177 (GRCm39) missense probably damaging 1.00
R7815:Hspg2 UTSW 4 137,239,775 (GRCm39) missense probably damaging 1.00
R7825:Hspg2 UTSW 4 137,286,160 (GRCm39) missense probably damaging 1.00
R7863:Hspg2 UTSW 4 137,292,135 (GRCm39) missense probably benign 0.03
R7885:Hspg2 UTSW 4 137,244,148 (GRCm39) missense probably damaging 1.00
R7899:Hspg2 UTSW 4 137,275,427 (GRCm39) missense possibly damaging 0.72
R7937:Hspg2 UTSW 4 137,278,243 (GRCm39) missense probably benign 0.01
R7975:Hspg2 UTSW 4 137,282,532 (GRCm39) missense probably benign 0.26
R8078:Hspg2 UTSW 4 137,235,333 (GRCm39) missense probably damaging 1.00
R8285:Hspg2 UTSW 4 137,239,974 (GRCm39) missense probably benign 0.18
R8314:Hspg2 UTSW 4 137,266,986 (GRCm39) missense probably benign 0.12
R8322:Hspg2 UTSW 4 137,246,290 (GRCm39) missense possibly damaging 0.88
R8323:Hspg2 UTSW 4 137,246,290 (GRCm39) missense possibly damaging 0.88
R8341:Hspg2 UTSW 4 137,246,290 (GRCm39) missense possibly damaging 0.88
R8383:Hspg2 UTSW 4 137,271,681 (GRCm39) missense possibly damaging 0.66
R8425:Hspg2 UTSW 4 137,278,178 (GRCm39) nonsense probably null
R8491:Hspg2 UTSW 4 137,281,030 (GRCm39) missense probably benign 0.00
R8525:Hspg2 UTSW 4 137,266,759 (GRCm39) missense probably damaging 0.98
R8978:Hspg2 UTSW 4 137,291,341 (GRCm39) missense probably benign 0.09
R9152:Hspg2 UTSW 4 137,249,876 (GRCm39) missense possibly damaging 0.89
R9166:Hspg2 UTSW 4 137,270,185 (GRCm39) missense probably damaging 1.00
R9175:Hspg2 UTSW 4 137,256,657 (GRCm39) missense probably damaging 0.98
R9210:Hspg2 UTSW 4 137,289,790 (GRCm39) missense probably benign 0.05
R9221:Hspg2 UTSW 4 137,287,726 (GRCm39) missense possibly damaging 0.79
R9325:Hspg2 UTSW 4 137,265,552 (GRCm39) missense probably damaging 1.00
R9339:Hspg2 UTSW 4 137,278,480 (GRCm39) missense probably benign
R9340:Hspg2 UTSW 4 137,296,827 (GRCm39) missense probably damaging 1.00
R9358:Hspg2 UTSW 4 137,244,909 (GRCm39) missense probably damaging 1.00
R9451:Hspg2 UTSW 4 137,238,380 (GRCm39) missense probably damaging 1.00
R9534:Hspg2 UTSW 4 137,268,072 (GRCm39) missense probably benign
R9656:Hspg2 UTSW 4 137,279,196 (GRCm39) missense probably benign
R9664:Hspg2 UTSW 4 137,266,887 (GRCm39) missense probably benign 0.03
R9695:Hspg2 UTSW 4 137,265,701 (GRCm39) missense probably damaging 1.00
R9741:Hspg2 UTSW 4 137,239,962 (GRCm39) missense probably damaging 1.00
V5622:Hspg2 UTSW 4 137,261,049 (GRCm39) missense probably damaging 0.99
V5622:Hspg2 UTSW 4 137,261,049 (GRCm39) missense probably damaging 0.99
X0028:Hspg2 UTSW 4 137,277,702 (GRCm39) missense probably benign
Z1177:Hspg2 UTSW 4 137,295,684 (GRCm39) missense possibly damaging 0.64
Z1177:Hspg2 UTSW 4 137,291,829 (GRCm39) missense probably damaging 0.99
Z1177:Hspg2 UTSW 4 137,277,778 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAACCCTACTTCTGGAGTC -3'
(R):5'- AGATCCATTCCTGACACCCTG -3'

Sequencing Primer
(F):5'- CAGCTTCCGAGGGGACAAG -3'
(R):5'- GCACTATGAAGTTGCTGG -3'
Posted On 2020-09-02