Mutagenetix > Incidental Mutation

Incidental Mutation 'R8324:Antxr2'

643977

Institutional Source

Beutler Lab

Gene Symbol

Antxr2

Ensembl Gene

ENSMUSG00000029338

Gene Name

anthrax toxin receptor 2

Synonyms

2310046B19Rik, CMG2, CMG-2, cI-35

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R8324 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

97882783-98031043 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 97938509 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 413 (N413S)

Ref Sequence

ENSEMBL: ENSMUSP00000142605 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031281] [ENSMUST00000199088]

AlphaFold

Q6DFX2

Predicted Effect

probably damaging
Transcript: ENSMUST00000031281
AA Change: N413S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000031281
Gene: ENSMUSG00000029338
AA Change: N413S

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
VWA	42	214	2.86e-18	SMART
Pfam:Anth_Ig	215	317	4e-38	PFAM
transmembrane domain	319	341	N/A	INTRINSIC
low complexity region	352	369	N/A	INTRINSIC
Pfam:Ant_C	394	485	7.4e-46	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000199088
AA Change: N413S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142605
Gene: ENSMUSG00000029338
AA Change: N413S

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
VWA	42	214	1.7e-20	SMART
transmembrane domain	319	341	N/A	INTRINSIC
low complexity region	352	369	N/A	INTRINSIC
Pfam:Ant_C	394	483	1.6e-41	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for null mutations display female infertility. Mice homozygous for one allele are highly resistant to Bacillus anthracis or anthrax toxin induced lethality. Young mice homozygous for a second allele display pregnancy-related premature death and failure of parturition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,290,395	S753P	probably damaging	Het
Acan	A	G	7: 79,091,056	E390G	probably damaging	Het
Bace2	C	T	16: 97,356,908	A36V	possibly damaging	Het
Caprin1	G	A	2: 103,783,181	R79*	probably null	Het
Cdan1	A	G	2: 120,727,325	V507A	probably benign	Het
Cdkl3	T	A	11: 52,022,879		probably null	Het
Chst5	A	T	8: 111,890,508	L160Q	probably benign	Het
Col11a1	C	G	3: 114,164,410	P1111R	probably damaging	Het
Col6a6	T	A	9: 105,755,654	E1470D	probably benign	Het
Cpped1	T	A	16: 11,805,476	T274S	probably benign	Het
Ctnnbl1	G	A	2: 157,779,815	E75K	probably damaging	Het
Cyp4f40	T	C	17: 32,659,528	S15P	probably benign	Het
Ddx46	T	C	13: 55,663,914	S643P	probably damaging	Het
Defb34	A	G	8: 19,123,798	Q16R	probably null	Het
Dhrs2	T	A	14: 55,238,764	V147E	probably damaging	Het
Dnah5	G	T	15: 28,346,865	R2498L	probably damaging	Het
Dpp10	T	A	1: 123,854,172	I93F	probably benign	Het
Eef1e1	T	A	13: 38,655,069	D104V	probably damaging	Het
Egfr	A	G	11: 16,858,971	Y55C	probably damaging	Het
Egfr	A	C	11: 16,908,885	I955L	probably damaging	Het
Ehbp1l1	C	A	19: 5,719,998	V426F	possibly damaging	Het
Fam234a	C	T	17: 26,218,698	V108I	probably benign	Het
Fzd8	T	A	18: 9,214,688	M590K	probably damaging	Het
Gm13287	T	C	4: 88,803,638	S129P	probably damaging	Het
Heatr5b	A	G	17: 78,755,364	S1919P	possibly damaging	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Ikbkap	C	T	4: 56,772,491	E877K	probably damaging	Het
Itpr2	T	C	6: 146,328,398	E1233G	probably damaging	Het
Kcnmb4	A	G	10: 116,418,314	L186P	probably damaging	Het
Krt72	T	A	15: 101,782,145	Y224F	probably damaging	Het
Loxhd1	T	C	18: 77,339,579		probably null	Het
Lrguk	A	G	6: 34,102,571	T914A	probably benign	Het
Lrrtm4	A	G	6: 80,021,991	T129A	probably damaging	Het
Mmp13	A	T	9: 7,276,636	I244F	possibly damaging	Het
Mob1a	T	A	6: 83,329,974	L41Q	probably damaging	Het
Mtcl1	T	C	17: 66,436,217	R426G	probably damaging	Het
Mybbp1a	T	C	11: 72,445,288		probably null	Het
Myh9	A	G	15: 77,788,917		probably null	Het
Myo1d	T	A	11: 80,557,521	D926V	probably damaging	Het
Ncapg	T	G	5: 45,695,668	H825Q	probably damaging	Het
Olfml1	T	C	7: 107,590,363	S212P	probably benign	Het
Olfr656	G	A	7: 104,618,114	R145H	probably benign	Het
Pak2	T	C	16: 32,052,211	N51S	probably benign	Het
Papln	T	C	12: 83,786,619	Y1132H	probably damaging	Het
Pax3	T	A	1: 78,193,789	R134S	probably damaging	Het
Pdzrn4	A	G	15: 92,770,937	E990G	probably damaging	Het
Peak1	A	T	9: 56,207,476	W1394R	probably damaging	Het
Pkn2	T	C	3: 142,829,010	N285D	probably benign	Het
Pramef12	A	C	4: 144,395,857	L39R	probably damaging	Het
Prrc2a	A	G	17: 35,156,984	S897P	possibly damaging	Het
Rad51	A	G	2: 119,123,831	T131A	possibly damaging	Het
Rc3h2	T	A	2: 37,400,726	T255S	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rictor	T	A	15: 6,745,562	V125E	probably damaging	Het
Rps6ka5	C	T	12: 100,558,487	D664N	possibly damaging	Het
Rreb1	T	A	13: 37,947,621	W1584R	probably damaging	Het
Rxra	T	C	2: 27,741,183	I142T	probably damaging	Het
Sall2	T	C	14: 52,312,886	T951A	probably benign	Het
Slc15a2	T	G	16: 36,759,307	N359T	probably damaging	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Slc6a13	T	C	6: 121,337,414	*603Q	probably null	Het
Sptb	T	C	12: 76,619,162	D894G	possibly damaging	Het
Srgn	A	G	10: 62,507,665	L17P	probably damaging	Het
Tmprss9	T	C	10: 80,897,371		probably null	Het
Trav9n-4	T	C	14: 53,294,946	F86L	probably benign	Het
Trp63	A	G	16: 25,876,734	Y482C	unknown	Het
Ttc9b	G	T	7: 27,653,969	A15S	probably damaging	Het
Urb1	A	T	16: 90,791,190	I410N	probably damaging	Het
Vmn2r82	A	T	10: 79,378,893	K237*	probably null	Het
Wwox	G	A	8: 114,489,005		probably null	Het

Other mutations in Antxr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00566:Antxr2	APN	5	97886607	splice site	probably benign
IGL00661:Antxr2	APN	5	98004296	missense	probably benign	0.26
IGL01105:Antxr2	APN	5	98004943	splice site	probably benign
IGL01472:Antxr2	APN	5	98027499	missense	probably benign	0.00
IGL01719:Antxr2	APN	5	97948273	missense	possibly damaging	0.82
IGL02184:Antxr2	APN	5	97977595	splice site	probably null
IGL02199:Antxr2	APN	5	97977595	splice site	probably null
IGL02250:Antxr2	APN	5	97977595	splice site	probably null
IGL02251:Antxr2	APN	5	97977595	splice site	probably null
IGL02368:Antxr2	APN	5	97949198	missense	probably damaging	1.00
IGL02447:Antxr2	APN	5	98030408	missense	possibly damaging	0.61
IGL02740:Antxr2	APN	5	98030392	splice site	probably benign
IGL02850:Antxr2	APN	5	98004078	missense	probably damaging	1.00
IGL02867:Antxr2	APN	5	97977650	missense	probably benign	0.00
IGL02889:Antxr2	APN	5	97977650	missense	probably benign	0.00
G1Funyon:Antxr2	UTSW	5	97977679	missense	probably benign	0.20
R0013:Antxr2	UTSW	5	97979985	missense	probably damaging	0.98
R0040:Antxr2	UTSW	5	97938425	missense	possibly damaging	0.74
R0040:Antxr2	UTSW	5	97938425	missense	possibly damaging	0.74
R0069:Antxr2	UTSW	5	97948250	missense	possibly damaging	0.95
R0184:Antxr2	UTSW	5	97980030	missense	probably damaging	1.00
R0367:Antxr2	UTSW	5	98029596	missense	probably benign	0.01
R0638:Antxr2	UTSW	5	97960637	nonsense	probably null
R0732:Antxr2	UTSW	5	97960708	splice site	probably null
R1255:Antxr2	UTSW	5	97975372	missense	probably benign	0.39
R1471:Antxr2	UTSW	5	97975340	missense	possibly damaging	0.88
R1520:Antxr2	UTSW	5	97960692	missense	probably benign	0.38
R1660:Antxr2	UTSW	5	97975350	nonsense	probably null
R1870:Antxr2	UTSW	5	98030438	missense	probably damaging	1.00
R2969:Antxr2	UTSW	5	98030416	nonsense	probably null
R3547:Antxr2	UTSW	5	97977657	missense	probably benign	0.09
R4237:Antxr2	UTSW	5	97938407	missense	probably damaging	1.00
R4660:Antxr2	UTSW	5	98004054	critical splice donor site	probably null
R4702:Antxr2	UTSW	5	97949169	critical splice donor site	probably null
R4893:Antxr2	UTSW	5	98004072	missense	probably damaging	1.00
R4997:Antxr2	UTSW	5	97977694	missense	probably benign	0.04
R5388:Antxr2	UTSW	5	97977599	critical splice donor site	probably null
R5604:Antxr2	UTSW	5	97948310	missense	probably damaging	0.98
R6093:Antxr2	UTSW	5	98030460	missense	probably damaging	0.99
R6118:Antxr2	UTSW	5	97949201	missense	probably damaging	1.00
R6130:Antxr2	UTSW	5	98004272	missense	possibly damaging	0.89
R6139:Antxr2	UTSW	5	97977706	splice site	probably null
R6992:Antxr2	UTSW	5	97960705	missense	probably benign	0.09
R8127:Antxr2	UTSW	5	97980017	nonsense	probably null
R8267:Antxr2	UTSW	5	97965762	critical splice acceptor site	probably null
R8301:Antxr2	UTSW	5	97977679	missense	probably benign	0.20
R8840:Antxr2	UTSW	5	98004910	missense	probably damaging	1.00
R9125:Antxr2	UTSW	5	98004114	missense	probably damaging	1.00
R9340:Antxr2	UTSW	5	97938447	missense	probably damaging	0.98
R9722:Antxr2	UTSW	5	97948327	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- GACCTTAGTCTTTCTCGGGG -3'
(R):5'- GGAACCCATTAAAGCTCAGGAG -3'

Sequencing Primer
(F):5'- CCTTAGTCTTTCTCGGGGGACAG -3'
(R):5'- CCCATTAAAGCTCAGGAGAAAAG -3'

Posted On

2020-09-02