Incidental Mutation 'R8324:Repin1'
ID 643979
Institutional Source Beutler Lab
Gene Symbol Repin1
Ensembl Gene ENSMUSG00000052751
Gene Name replication initiator 1
Synonyms Zfp464, E430037F08Rik, AP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 48593883-48599082 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 48597345 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 403 (E403*)
Ref Sequence ENSEMBL: ENSMUSP00000118890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009420] [ENSMUST00000118229] [ENSMUST00000135151] [ENSMUST00000154010] [ENSMUST00000163452] [ENSMUST00000204095] [ENSMUST00000204121] [ENSMUST00000204521]
AlphaFold Q5U4E2
Predicted Effect probably null
Transcript: ENSMUST00000009420
AA Change: E347*
SMART Domains Protein: ENSMUSP00000009420
Gene: ENSMUSG00000052751
AA Change: E347*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118229
AA Change: E400*
SMART Domains Protein: ENSMUSP00000113548
Gene: ENSMUSG00000052751
AA Change: E400*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135151
AA Change: E403*
SMART Domains Protein: ENSMUSP00000118890
Gene: ENSMUSG00000052751
AA Change: E403*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
Pfam:zf-C2H2_6 284 300 1.4e-1 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154010
AA Change: E347*
SMART Domains Protein: ENSMUSP00000121975
Gene: ENSMUSG00000052751
AA Change: E347*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163452
AA Change: E347*
SMART Domains Protein: ENSMUSP00000132365
Gene: ENSMUSG00000052751
AA Change: E347*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204095
SMART Domains Protein: ENSMUSP00000145192
Gene: ENSMUSG00000007216

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
ZnF_C2H2 104 126 7.9e-4 SMART
ZnF_C2H2 132 154 1.69e-3 SMART
ZnF_C2H2 160 182 2.36e-2 SMART
ZnF_C2H2 188 210 4.11e-2 SMART
ZnF_C2H2 279 301 1.84e-4 SMART
ZnF_C2H2 307 329 4.94e-5 SMART
ZnF_C2H2 335 357 2.95e-3 SMART
ZnF_C2H2 364 386 1.36e-2 SMART
ZnF_C2H2 446 468 1.3e-4 SMART
ZnF_C2H2 474 496 2.12e-4 SMART
ZnF_C2H2 502 524 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204121
Predicted Effect probably benign
Transcript: ENSMUST00000204521
Meta Mutation Damage Score 0.9647 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele improves in insulin sensitivity and glucose metabolism in Leprdb homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,290,395 S753P probably damaging Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Antxr2 T C 5: 97,938,509 N413S probably damaging Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
Caprin1 G A 2: 103,783,181 R79* probably null Het
Cdan1 A G 2: 120,727,325 V507A probably benign Het
Cdkl3 T A 11: 52,022,879 probably null Het
Chst5 A T 8: 111,890,508 L160Q probably benign Het
Col11a1 C G 3: 114,164,410 P1111R probably damaging Het
Col6a6 T A 9: 105,755,654 E1470D probably benign Het
Cpped1 T A 16: 11,805,476 T274S probably benign Het
Ctnnbl1 G A 2: 157,779,815 E75K probably damaging Het
Cyp4f40 T C 17: 32,659,528 S15P probably benign Het
Ddx46 T C 13: 55,663,914 S643P probably damaging Het
Defb34 A G 8: 19,123,798 Q16R probably null Het
Dhrs2 T A 14: 55,238,764 V147E probably damaging Het
Dnah5 G T 15: 28,346,865 R2498L probably damaging Het
Dpp10 T A 1: 123,854,172 I93F probably benign Het
Eef1e1 T A 13: 38,655,069 D104V probably damaging Het
Egfr A G 11: 16,858,971 Y55C probably damaging Het
Egfr A C 11: 16,908,885 I955L probably damaging Het
Ehbp1l1 C A 19: 5,719,998 V426F possibly damaging Het
Fam234a C T 17: 26,218,698 V108I probably benign Het
Fzd8 T A 18: 9,214,688 M590K probably damaging Het
Gm13287 T C 4: 88,803,638 S129P probably damaging Het
Heatr5b A G 17: 78,755,364 S1919P possibly damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ikbkap C T 4: 56,772,491 E877K probably damaging Het
Itpr2 T C 6: 146,328,398 E1233G probably damaging Het
Kcnmb4 A G 10: 116,418,314 L186P probably damaging Het
Krt72 T A 15: 101,782,145 Y224F probably damaging Het
Loxhd1 T C 18: 77,339,579 probably null Het
Lrguk A G 6: 34,102,571 T914A probably benign Het
Lrrtm4 A G 6: 80,021,991 T129A probably damaging Het
Mmp13 A T 9: 7,276,636 I244F possibly damaging Het
Mob1a T A 6: 83,329,974 L41Q probably damaging Het
Mtcl1 T C 17: 66,436,217 R426G probably damaging Het
Mybbp1a T C 11: 72,445,288 probably null Het
Myh9 A G 15: 77,788,917 probably null Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Ncapg T G 5: 45,695,668 H825Q probably damaging Het
Olfml1 T C 7: 107,590,363 S212P probably benign Het
Olfr656 G A 7: 104,618,114 R145H probably benign Het
Pak2 T C 16: 32,052,211 N51S probably benign Het
Papln T C 12: 83,786,619 Y1132H probably damaging Het
Pax3 T A 1: 78,193,789 R134S probably damaging Het
Pdzrn4 A G 15: 92,770,937 E990G probably damaging Het
Peak1 A T 9: 56,207,476 W1394R probably damaging Het
Pkn2 T C 3: 142,829,010 N285D probably benign Het
Pramef12 A C 4: 144,395,857 L39R probably damaging Het
Prrc2a A G 17: 35,156,984 S897P possibly damaging Het
Rad51 A G 2: 119,123,831 T131A possibly damaging Het
Rc3h2 T A 2: 37,400,726 T255S possibly damaging Het
Rictor T A 15: 6,745,562 V125E probably damaging Het
Rps6ka5 C T 12: 100,558,487 D664N possibly damaging Het
Rreb1 T A 13: 37,947,621 W1584R probably damaging Het
Rxra T C 2: 27,741,183 I142T probably damaging Het
Sall2 T C 14: 52,312,886 T951A probably benign Het
Slc15a2 T G 16: 36,759,307 N359T probably damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc6a13 T C 6: 121,337,414 *603Q probably null Het
Sptb T C 12: 76,619,162 D894G possibly damaging Het
Srgn A G 10: 62,507,665 L17P probably damaging Het
Tmprss9 T C 10: 80,897,371 probably null Het
Trav9n-4 T C 14: 53,294,946 F86L probably benign Het
Trp63 A G 16: 25,876,734 Y482C unknown Het
Ttc9b G T 7: 27,653,969 A15S probably damaging Het
Urb1 A T 16: 90,791,190 I410N probably damaging Het
Vmn2r82 A T 10: 79,378,893 K237* probably null Het
Wwox G A 8: 114,489,005 probably null Het
Other mutations in Repin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Repin1 APN 6 48596905 missense probably damaging 1.00
IGL01103:Repin1 APN 6 48597953 intron probably benign
IGL02027:Repin1 APN 6 48596473 missense probably damaging 1.00
IGL02143:Repin1 APN 6 48597121 missense probably damaging 1.00
R0395:Repin1 UTSW 6 48597525 missense probably damaging 1.00
R1233:Repin1 UTSW 6 48597834 missense possibly damaging 0.72
R1743:Repin1 UTSW 6 48597750 missense probably damaging 0.96
R2259:Repin1 UTSW 6 48596530 missense probably benign 0.00
R4509:Repin1 UTSW 6 48596526 missense possibly damaging 0.77
R5008:Repin1 UTSW 6 48596608 missense probably damaging 1.00
R5009:Repin1 UTSW 6 48594845 intron probably benign
R5425:Repin1 UTSW 6 48596431 missense probably benign 0.18
R5829:Repin1 UTSW 6 48594832 intron probably benign
R6350:Repin1 UTSW 6 48597628 missense probably damaging 0.98
R6841:Repin1 UTSW 6 48597925 missense possibly damaging 0.95
R6854:Repin1 UTSW 6 48593891 intron probably benign
R7067:Repin1 UTSW 6 48597916 nonsense probably null
R7636:Repin1 UTSW 6 48596365 missense probably benign 0.00
R7699:Repin1 UTSW 6 48597822 missense probably damaging 0.96
R7700:Repin1 UTSW 6 48597822 missense probably damaging 0.96
R7747:Repin1 UTSW 6 48597345 nonsense probably null
R7748:Repin1 UTSW 6 48597345 nonsense probably null
R7781:Repin1 UTSW 6 48597345 nonsense probably null
R7815:Repin1 UTSW 6 48597345 nonsense probably null
R7820:Repin1 UTSW 6 48597345 nonsense probably null
R7869:Repin1 UTSW 6 48597345 nonsense probably null
R7988:Repin1 UTSW 6 48597345 nonsense probably null
R7991:Repin1 UTSW 6 48597345 nonsense probably null
R8078:Repin1 UTSW 6 48597345 nonsense probably null
R8079:Repin1 UTSW 6 48597345 nonsense probably null
R8080:Repin1 UTSW 6 48597345 nonsense probably null
R8088:Repin1 UTSW 6 48597345 nonsense probably null
R8089:Repin1 UTSW 6 48597345 nonsense probably null
R8130:Repin1 UTSW 6 48597345 nonsense probably null
R8131:Repin1 UTSW 6 48597345 nonsense probably null
R8325:Repin1 UTSW 6 48597345 nonsense probably null
R8342:Repin1 UTSW 6 48597345 nonsense probably null
R8411:Repin1 UTSW 6 48597345 nonsense probably null
R8488:Repin1 UTSW 6 48594018 missense probably damaging 0.98
R8542:Repin1 UTSW 6 48597345 nonsense probably null
R8543:Repin1 UTSW 6 48597345 nonsense probably null
R8544:Repin1 UTSW 6 48597345 nonsense probably null
R8697:Repin1 UTSW 6 48597345 nonsense probably null
R8699:Repin1 UTSW 6 48597345 nonsense probably null
R8701:Repin1 UTSW 6 48597345 nonsense probably null
R8702:Repin1 UTSW 6 48597345 nonsense probably null
R8731:Repin1 UTSW 6 48597345 nonsense probably null
R8732:Repin1 UTSW 6 48597345 nonsense probably null
R8780:Repin1 UTSW 6 48597139 missense probably damaging 0.99
R8879:Repin1 UTSW 6 48597433 missense possibly damaging 0.73
R9049:Repin1 UTSW 6 48597712 missense possibly damaging 0.86
R9465:Repin1 UTSW 6 48594943 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCATACATACCGGCGAGAAG -3'
(R):5'- CATAGGGTTTCTCGCCTGTG -3'

Sequencing Primer
(F):5'- TACCCATGCACCGAGTGTGG -3'
(R):5'- TGGCTGCCCTGTGAGAAAC -3'
Posted On 2020-09-02