Incidental Mutation 'R8324:Mob1a'
ID 643981
Institutional Source Beutler Lab
Gene Symbol Mob1a
Ensembl Gene ENSMUSG00000043131
Gene Name MOB kinase activator 1A
Synonyms 4022402H07Rik, Mobkl1b, Mobk1b
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.195) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 83303016-83320758 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 83306956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 41 (L41Q)
Ref Sequence ENSEMBL: ENSMUSP00000054452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038658] [ENSMUST00000055261] [ENSMUST00000101245] [ENSMUST00000133045] [ENSMUST00000155580] [ENSMUST00000204472]
AlphaFold Q921Y0
Predicted Effect probably damaging
Transcript: ENSMUST00000038658
AA Change: L41Q

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039115
Gene: ENSMUSG00000043131
AA Change: L41Q

DomainStartEndE-ValueType
Pfam:Mob1_phocein 29 63 1.1e-9 PFAM
Pfam:Mob1_phocein 60 129 3.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000055261
AA Change: L41Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054452
Gene: ENSMUSG00000043131
AA Change: L41Q

DomainStartEndE-ValueType
Pfam:Mob1_phocein 29 205 3.4e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101245
AA Change: L41Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098802
Gene: ENSMUSG00000043131
AA Change: L41Q

DomainStartEndE-ValueType
Mob1_phocein 31 204 1.26e-118 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133045
Predicted Effect probably benign
Transcript: ENSMUST00000155580
Predicted Effect probably benign
Transcript: ENSMUST00000204472
SMART Domains Protein: ENSMUSP00000145222
Gene: ENSMUSG00000005667

DomainStartEndE-ValueType
Pfam:THF_DHG_CYH 20 97 2.2e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the Hippo signaling pathway, which controls organ size and tumor growth by enhancing apoptosis. Loss of the encoded protein results in cell proliferation and cancer formation. The encoded protein is also involved in the control of microtubule stability during cytokinesis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Mob1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Mob1a APN 6 83,309,468 (GRCm39) missense probably damaging 1.00
IGL00838:Mob1a APN 6 83,315,313 (GRCm39) missense possibly damaging 0.94
IGL01685:Mob1a APN 6 83,309,485 (GRCm39) missense probably benign 0.00
R0612:Mob1a UTSW 6 83,311,140 (GRCm39) missense probably benign 0.31
R4870:Mob1a UTSW 6 83,317,221 (GRCm39) missense probably benign 0.01
R6682:Mob1a UTSW 6 83,311,132 (GRCm39) missense possibly damaging 0.54
R7299:Mob1a UTSW 6 83,315,431 (GRCm39) splice site probably null
R7417:Mob1a UTSW 6 83,309,492 (GRCm39) missense probably benign 0.00
R7968:Mob1a UTSW 6 83,315,287 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCCGTTTATACACTTAAAATGCC -3'
(R):5'- AGGTGGCCTTACTCATTTCTTG -3'

Sequencing Primer
(F):5'- GCCAGTTTTCTTTCATTGCTAAAAC -3'
(R):5'- CAAGGCCTTTGACAAGTAAAGTC -3'
Posted On 2020-09-02