Mutagenetix > Incidental Mutation

Incidental Mutation 'R8324:Slc6a13'

643982

Institutional Source

Beutler Lab

Gene Symbol

Slc6a13

Ensembl Gene

ENSMUSG00000030108

Gene Name

solute carrier family 6 (neurotransmitter transporter, GABA), member 13

Synonyms

Gat2, Gabt3

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.721) question?

Stock #

R8324 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121300227-121337733 bp(+) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to C at 121337414 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Glutamine at position 603 (*603Q)

Ref Sequence

ENSEMBL: ENSMUSP00000066779 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064580]

AlphaFold

P31649

Predicted Effect

probably null
Transcript: ENSMUST00000064580
AA Change: *603Q

SMART Domains

Protein: ENSMUSP00000066779
Gene: ENSMUSG00000030108
AA Change: *603Q

Domain	Start	End	E-Value	Type
Pfam:SNF	32	556	6.2e-252	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced taurine levels in the liver and increased taurine levels in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,290,395	S753P	probably damaging	Het
Acan	A	G	7: 79,091,056	E390G	probably damaging	Het
Antxr2	T	C	5: 97,938,509	N413S	probably damaging	Het
Bace2	C	T	16: 97,356,908	A36V	possibly damaging	Het
Caprin1	G	A	2: 103,783,181	R79*	probably null	Het
Cdan1	A	G	2: 120,727,325	V507A	probably benign	Het
Cdkl3	T	A	11: 52,022,879		probably null	Het
Chst5	A	T	8: 111,890,508	L160Q	probably benign	Het
Col11a1	C	G	3: 114,164,410	P1111R	probably damaging	Het
Col6a6	T	A	9: 105,755,654	E1470D	probably benign	Het
Cpped1	T	A	16: 11,805,476	T274S	probably benign	Het
Ctnnbl1	G	A	2: 157,779,815	E75K	probably damaging	Het
Cyp4f40	T	C	17: 32,659,528	S15P	probably benign	Het
Ddx46	T	C	13: 55,663,914	S643P	probably damaging	Het
Defb34	A	G	8: 19,123,798	Q16R	probably null	Het
Dhrs2	T	A	14: 55,238,764	V147E	probably damaging	Het
Dnah5	G	T	15: 28,346,865	R2498L	probably damaging	Het
Dpp10	T	A	1: 123,854,172	I93F	probably benign	Het
Eef1e1	T	A	13: 38,655,069	D104V	probably damaging	Het
Egfr	A	G	11: 16,858,971	Y55C	probably damaging	Het
Egfr	A	C	11: 16,908,885	I955L	probably damaging	Het
Ehbp1l1	C	A	19: 5,719,998	V426F	possibly damaging	Het
Fam234a	C	T	17: 26,218,698	V108I	probably benign	Het
Fzd8	T	A	18: 9,214,688	M590K	probably damaging	Het
Gm13287	T	C	4: 88,803,638	S129P	probably damaging	Het
Heatr5b	A	G	17: 78,755,364	S1919P	possibly damaging	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Ikbkap	C	T	4: 56,772,491	E877K	probably damaging	Het
Itpr2	T	C	6: 146,328,398	E1233G	probably damaging	Het
Kcnmb4	A	G	10: 116,418,314	L186P	probably damaging	Het
Krt72	T	A	15: 101,782,145	Y224F	probably damaging	Het
Loxhd1	T	C	18: 77,339,579		probably null	Het
Lrguk	A	G	6: 34,102,571	T914A	probably benign	Het
Lrrtm4	A	G	6: 80,021,991	T129A	probably damaging	Het
Mmp13	A	T	9: 7,276,636	I244F	possibly damaging	Het
Mob1a	T	A	6: 83,329,974	L41Q	probably damaging	Het
Mtcl1	T	C	17: 66,436,217	R426G	probably damaging	Het
Mybbp1a	T	C	11: 72,445,288		probably null	Het
Myh9	A	G	15: 77,788,917		probably null	Het
Myo1d	T	A	11: 80,557,521	D926V	probably damaging	Het
Ncapg	T	G	5: 45,695,668	H825Q	probably damaging	Het
Olfml1	T	C	7: 107,590,363	S212P	probably benign	Het
Olfr656	G	A	7: 104,618,114	R145H	probably benign	Het
Pak2	T	C	16: 32,052,211	N51S	probably benign	Het
Papln	T	C	12: 83,786,619	Y1132H	probably damaging	Het
Pax3	T	A	1: 78,193,789	R134S	probably damaging	Het
Pdzrn4	A	G	15: 92,770,937	E990G	probably damaging	Het
Peak1	A	T	9: 56,207,476	W1394R	probably damaging	Het
Pkn2	T	C	3: 142,829,010	N285D	probably benign	Het
Pramef12	A	C	4: 144,395,857	L39R	probably damaging	Het
Prrc2a	A	G	17: 35,156,984	S897P	possibly damaging	Het
Rad51	A	G	2: 119,123,831	T131A	possibly damaging	Het
Rc3h2	T	A	2: 37,400,726	T255S	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rictor	T	A	15: 6,745,562	V125E	probably damaging	Het
Rps6ka5	C	T	12: 100,558,487	D664N	possibly damaging	Het
Rreb1	T	A	13: 37,947,621	W1584R	probably damaging	Het
Rxra	T	C	2: 27,741,183	I142T	probably damaging	Het
Sall2	T	C	14: 52,312,886	T951A	probably benign	Het
Slc15a2	T	G	16: 36,759,307	N359T	probably damaging	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Sptb	T	C	12: 76,619,162	D894G	possibly damaging	Het
Srgn	A	G	10: 62,507,665	L17P	probably damaging	Het
Tmprss9	T	C	10: 80,897,371		probably null	Het
Trav9n-4	T	C	14: 53,294,946	F86L	probably benign	Het
Trp63	A	G	16: 25,876,734	Y482C	unknown	Het
Ttc9b	G	T	7: 27,653,969	A15S	probably damaging	Het
Urb1	A	T	16: 90,791,190	I410N	probably damaging	Het
Vmn2r82	A	T	10: 79,378,893	K237*	probably null	Het
Wwox	G	A	8: 114,489,005		probably null	Het

Other mutations in Slc6a13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01131:Slc6a13	APN	6	121321641	missense	probably damaging	1.00
IGL01947:Slc6a13	APN	6	121325157	critical splice donor site	probably null
IGL01969:Slc6a13	APN	6	121335642	missense	probably damaging	1.00
IGL02546:Slc6a13	APN	6	121333364	missense	probably benign
IGL02988:Slc6a13	APN	6	121326107	unclassified	probably benign
IGL03093:Slc6a13	APN	6	121332448	missense	probably damaging	1.00
IGL03358:Slc6a13	APN	6	121334536	missense	probably benign
IGL03384:Slc6a13	APN	6	121332391	missense	probably damaging	1.00
ANU74:Slc6a13	UTSW	6	121334876	missense	probably benign	0.42
R0217:Slc6a13	UTSW	6	121324320	missense	probably damaging	0.99
R0230:Slc6a13	UTSW	6	121324303	missense	probably benign	0.03
R0744:Slc6a13	UTSW	6	121302867	missense	probably damaging	1.00
R1546:Slc6a13	UTSW	6	121332374	missense	possibly damaging	0.78
R1604:Slc6a13	UTSW	6	121332369	missense	probably benign	0.02
R1654:Slc6a13	UTSW	6	121336926	missense	probably benign
R1781:Slc6a13	UTSW	6	121334852	missense	probably damaging	0.99
R1978:Slc6a13	UTSW	6	121332373	missense	probably damaging	1.00
R2130:Slc6a13	UTSW	6	121325041	missense	possibly damaging	0.77
R4570:Slc6a13	UTSW	6	121336142	critical splice donor site	probably null
R4623:Slc6a13	UTSW	6	121325145	missense	probably damaging	0.99
R4755:Slc6a13	UTSW	6	121325049	missense	probably damaging	1.00
R5068:Slc6a13	UTSW	6	121333342	missense	probably damaging	0.99
R5485:Slc6a13	UTSW	6	121336073	missense	probably damaging	1.00
R5687:Slc6a13	UTSW	6	121302741	missense	probably benign	0.00
R6045:Slc6a13	UTSW	6	121321628	missense	probably damaging	1.00
R6235:Slc6a13	UTSW	6	121302794	missense	probably benign	0.02
R6338:Slc6a13	UTSW	6	121334839	missense	probably damaging	0.96
R6393:Slc6a13	UTSW	6	121336842	missense	possibly damaging	0.83
R6844:Slc6a13	UTSW	6	121325053	missense	probably damaging	0.99
R7379:Slc6a13	UTSW	6	121336839	nonsense	probably null
R7734:Slc6a13	UTSW	6	121337375	missense	probably benign	0.00
R7800:Slc6a13	UTSW	6	121321699	missense	probably damaging	0.98
R7862:Slc6a13	UTSW	6	121335630	missense	probably damaging	1.00
R7935:Slc6a13	UTSW	6	121334491	missense	possibly damaging	0.46
R8177:Slc6a13	UTSW	6	121325028	nonsense	probably null
R8457:Slc6a13	UTSW	6	121326104	splice site	probably null
R8992:Slc6a13	UTSW	6	121336942	nonsense	probably null
R8995:Slc6a13	UTSW	6	121325053	missense	probably damaging	1.00
R9104:Slc6a13	UTSW	6	121336085	missense	probably benign
R9168:Slc6a13	UTSW	6	121325083	missense	probably damaging	1.00
R9235:Slc6a13	UTSW	6	121325025	missense	probably damaging	0.98
R9242:Slc6a13	UTSW	6	121318269	missense	probably damaging	0.99
RF020:Slc6a13	UTSW	6	121324351	critical splice donor site	probably null
Z1177:Slc6a13	UTSW	6	121334503	missense	possibly damaging	0.52

Predicted Primers

PCR Primer
(F):5'- GTTGGCAACTGGAAGCAGAC -3'
(R):5'- ACAATGTGTGGACCACCCTG -3'

Sequencing Primer
(F):5'- GACATTTGTAATGAGAGATGCTGCC -3'
(R):5'- TGTGTGGACCACCCTGGAATAG -3'

Posted On

2020-09-02