Incidental Mutation 'R8324:Olfr656'
ID643986
Institutional Source Beutler Lab
Gene Symbol Olfr656
Ensembl Gene ENSMUSG00000073924
Gene Nameolfactory receptor 656
SynonymsGA_x6K02T2PBJ9-7245486-7246451, MOR27-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8324 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104613955-104621603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104618114 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 145 (R145H)
Ref Sequence ENSEMBL: ENSMUSP00000149625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098172] [ENSMUST00000215575]
Predicted Effect probably benign
Transcript: ENSMUST00000098172
AA Change: R153H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000095774
Gene: ENSMUSG00000073924
AA Change: R153H

DomainStartEndE-ValueType
Pfam:7tm_4 41 319 5.2e-105 PFAM
Pfam:7TM_GPCR_Srsx 42 316 1.1e-8 PFAM
Pfam:7tm_1 51 302 4.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215575
AA Change: R145H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,290,395 S753P probably damaging Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Antxr2 T C 5: 97,938,509 N413S probably damaging Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
Caprin1 G A 2: 103,783,181 R79* probably null Het
Cdan1 A G 2: 120,727,325 V507A probably benign Het
Cdkl3 T A 11: 52,022,879 probably null Het
Chst5 A T 8: 111,890,508 L160Q probably benign Het
Col11a1 C G 3: 114,164,410 P1111R probably damaging Het
Col6a6 T A 9: 105,755,654 E1470D probably benign Het
Cpped1 T A 16: 11,805,476 T274S probably benign Het
Ctnnbl1 G A 2: 157,779,815 E75K probably damaging Het
Cyp4f40 T C 17: 32,659,528 S15P probably benign Het
Ddx46 T C 13: 55,663,914 S643P probably damaging Het
Defb34 A G 8: 19,123,798 Q16R probably null Het
Dhrs2 T A 14: 55,238,764 V147E probably damaging Het
Dnah5 G T 15: 28,346,865 R2498L probably damaging Het
Dpp10 T A 1: 123,854,172 I93F probably benign Het
Eef1e1 T A 13: 38,655,069 D104V probably damaging Het
Egfr A G 11: 16,858,971 Y55C probably damaging Het
Egfr A C 11: 16,908,885 I955L probably damaging Het
Ehbp1l1 C A 19: 5,719,998 V426F possibly damaging Het
Fam234a C T 17: 26,218,698 V108I probably benign Het
Fzd8 T A 18: 9,214,688 M590K probably damaging Het
Gm13287 T C 4: 88,803,638 S129P probably damaging Het
Heatr5b A G 17: 78,755,364 S1919P possibly damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ikbkap C T 4: 56,772,491 E877K probably damaging Het
Itpr2 T C 6: 146,328,398 E1233G probably damaging Het
Kcnmb4 A G 10: 116,418,314 L186P probably damaging Het
Krt72 T A 15: 101,782,145 Y224F probably damaging Het
Loxhd1 T C 18: 77,339,579 probably null Het
Lrguk A G 6: 34,102,571 T914A probably benign Het
Lrrtm4 A G 6: 80,021,991 T129A probably damaging Het
Mmp13 A T 9: 7,276,636 I244F possibly damaging Het
Mob1a T A 6: 83,329,974 L41Q probably damaging Het
Mtcl1 T C 17: 66,436,217 R426G probably damaging Het
Mybbp1a T C 11: 72,445,288 probably null Het
Myh9 A G 15: 77,788,917 probably null Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Ncapg T G 5: 45,695,668 H825Q probably damaging Het
Olfml1 T C 7: 107,590,363 S212P probably benign Het
Pak2 T C 16: 32,052,211 N51S probably benign Het
Papln T C 12: 83,786,619 Y1132H probably damaging Het
Pax3 T A 1: 78,193,789 R134S probably damaging Het
Pdzrn4 A G 15: 92,770,937 E990G probably damaging Het
Peak1 A T 9: 56,207,476 W1394R probably damaging Het
Pkn2 T C 3: 142,829,010 N285D probably benign Het
Pramef12 A C 4: 144,395,857 L39R probably damaging Het
Prrc2a A G 17: 35,156,984 S897P possibly damaging Het
Rad51 A G 2: 119,123,831 T131A possibly damaging Het
Rc3h2 T A 2: 37,400,726 T255S possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rictor T A 15: 6,745,562 V125E probably damaging Het
Rps6ka5 C T 12: 100,558,487 D664N possibly damaging Het
Rreb1 T A 13: 37,947,621 W1584R probably damaging Het
Rxra T C 2: 27,741,183 I142T probably damaging Het
Sall2 T C 14: 52,312,886 T951A probably benign Het
Slc15a2 T G 16: 36,759,307 N359T probably damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc6a13 T C 6: 121,337,414 *603Q probably null Het
Sptb T C 12: 76,619,162 D894G possibly damaging Het
Srgn A G 10: 62,507,665 L17P probably damaging Het
Tmprss9 T C 10: 80,897,371 probably null Het
Trav9n-4 T C 14: 53,294,946 F86L probably benign Het
Trp63 A G 16: 25,876,734 Y482C unknown Het
Ttc9b G T 7: 27,653,969 A15S probably damaging Het
Urb1 A T 16: 90,791,190 I410N probably damaging Het
Vmn2r82 A T 10: 79,378,893 K237* probably null Het
Wwox G A 8: 114,489,005 probably null Het
Other mutations in Olfr656
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Olfr656 APN 7 104617721 missense probably damaging 0.98
IGL01908:Olfr656 APN 7 104617699 missense probably damaging 1.00
IGL02695:Olfr656 APN 7 104618471 missense probably damaging 1.00
IGL03055:Olfr656 UTSW 7 104618206 missense probably damaging 1.00
R0128:Olfr656 UTSW 7 104618581 missense probably damaging 1.00
R0184:Olfr656 UTSW 7 104618240 missense probably damaging 1.00
R4674:Olfr656 UTSW 7 104618424 nonsense probably null
R4675:Olfr656 UTSW 7 104618424 nonsense probably null
R4723:Olfr656 UTSW 7 104618489 missense possibly damaging 0.56
R4979:Olfr656 UTSW 7 104618605 missense probably null 0.03
R6273:Olfr656 UTSW 7 104617895 missense probably damaging 1.00
R6359:Olfr656 UTSW 7 104618303 missense probably damaging 1.00
R6582:Olfr656 UTSW 7 104618441 missense probably damaging 1.00
R6750:Olfr656 UTSW 7 104618113 missense probably damaging 0.99
R7426:Olfr656 UTSW 7 104617852 missense probably damaging 1.00
R7786:Olfr656 UTSW 7 104617718 missense probably benign 0.02
R8068:Olfr656 UTSW 7 104618253 nonsense probably null
R8486:Olfr656 UTSW 7 104617862 missense possibly damaging 0.47
X0065:Olfr656 UTSW 7 104617758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACCATTGATTTGGCTGC -3'
(R):5'- GCCCATACACACGATTAGGTC -3'

Sequencing Primer
(F):5'- TTCTCCACAGTACCAAAGCTACTGG -3'
(R):5'- CCATACACACGATTAGGTCTGGTG -3'
Posted On2020-09-02