Incidental Mutation 'R8324:Chst5'
ID 643989
Institutional Source Beutler Lab
Gene Symbol Chst5
Ensembl Gene ENSMUSG00000031952
Gene Name carbohydrate sulfotransferase 5
Synonyms I-GlcNAc6ST, GST-4
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 112615767-112636831 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 112617140 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 160 (L160Q)
Ref Sequence ENSEMBL: ENSMUSP00000034430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034430]
AlphaFold Q9QUP4
Predicted Effect probably benign
Transcript: ENSMUST00000034430
AA Change: L160Q

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000034430
Gene: ENSMUSG00000031952
AA Change: L160Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Sulfotransfer_1 40 357 1.2e-25 PFAM
Pfam:Sulfotransfer_3 41 294 4.7e-16 PFAM
low complexity region 363 376 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the transfer of a sulfate group to the GlcNAc residues of keratan. Keratan sulfate helps maintain corneal transparency. Defects in this gene are a cause of macular corneal dystrophy (MCD). [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in thinner corneas that show abnormally close collagen fibrillar packing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Chst5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Chst5 APN 8 112,617,314 (GRCm39) missense probably damaging 1.00
IGL02336:Chst5 APN 8 112,616,949 (GRCm39) missense probably damaging 0.99
IGL02634:Chst5 APN 8 112,617,477 (GRCm39) missense probably damaging 1.00
R0606:Chst5 UTSW 8 112,617,551 (GRCm39) missense probably benign 0.05
R1552:Chst5 UTSW 8 112,616,912 (GRCm39) missense probably damaging 0.99
R2094:Chst5 UTSW 8 112,617,176 (GRCm39) missense probably benign 0.01
R3769:Chst5 UTSW 8 112,616,513 (GRCm39) missense possibly damaging 0.67
R4135:Chst5 UTSW 8 112,616,816 (GRCm39) missense probably damaging 1.00
R4872:Chst5 UTSW 8 112,617,192 (GRCm39) missense possibly damaging 0.61
R5658:Chst5 UTSW 8 112,617,422 (GRCm39) missense probably damaging 1.00
R5759:Chst5 UTSW 8 112,616,842 (GRCm39) missense probably benign 0.25
R5893:Chst5 UTSW 8 112,616,828 (GRCm39) missense probably damaging 1.00
R6657:Chst5 UTSW 8 112,616,906 (GRCm39) missense probably benign 0.00
R6731:Chst5 UTSW 8 112,616,676 (GRCm39) missense probably benign 0.00
R7406:Chst5 UTSW 8 112,617,245 (GRCm39) missense probably benign 0.00
R7535:Chst5 UTSW 8 112,616,795 (GRCm39) missense probably damaging 1.00
R7727:Chst5 UTSW 8 112,617,557 (GRCm39) missense probably benign 0.25
R7835:Chst5 UTSW 8 112,617,234 (GRCm39) missense probably damaging 1.00
R7843:Chst5 UTSW 8 112,617,204 (GRCm39) missense probably benign 0.00
R8257:Chst5 UTSW 8 112,617,092 (GRCm39) missense probably damaging 1.00
R8444:Chst5 UTSW 8 112,617,395 (GRCm39) missense probably damaging 1.00
R8458:Chst5 UTSW 8 112,617,422 (GRCm39) missense probably damaging 1.00
R9001:Chst5 UTSW 8 112,616,534 (GRCm39) missense probably benign
R9223:Chst5 UTSW 8 112,617,492 (GRCm39) missense probably benign 0.13
R9517:Chst5 UTSW 8 112,616,652 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TAGCGATCTTGCAAGAAGGGC -3'
(R):5'- ACATGGACGTATTTGATGCCTACC -3'

Sequencing Primer
(F):5'- TACCCAGGACGATGCCATTGTC -3'
(R):5'- TGATGCCTACCTGCCCTGG -3'
Posted On 2020-09-02