Incidental Mutation 'R8324:Wwox'
ID 643990
Institutional Source Beutler Lab
Gene Symbol Wwox
Ensembl Gene ENSMUSG00000004637
Gene Name WW domain-containing oxidoreductase
Synonyms WOX1, 9030416C10Rik, 5330426P09Rik
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.907) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 115166395-116079447 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 115215745 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004756] [ENSMUST00000109108] [ENSMUST00000160862]
AlphaFold Q91WL8
Predicted Effect probably null
Transcript: ENSMUST00000004756
SMART Domains Protein: ENSMUSP00000004756
Gene: ENSMUSG00000004637

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 3e-9 PFAM
Pfam:adh_short 125 269 2.2e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109108
SMART Domains Protein: ENSMUSP00000104736
Gene: ENSMUSG00000004637

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.4e-9 PFAM
Pfam:adh_short 125 270 4e-20 PFAM
Pfam:adh_short_C2 131 268 2.4e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160862
SMART Domains Protein: ENSMUSP00000125626
Gene: ENSMUSG00000004637

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.3e-9 PFAM
Pfam:adh_short 125 270 3.7e-20 PFAM
Pfam:adh_short_C2 131 268 2.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) protein family. This gene spans the FRA16D common chromosomal fragile site and appears to function as a tumor suppressor gene. Expression of the encoded protein is able to induce apoptosis, while defects in this gene are associated with multiple types of cancer. Disruption of this gene is also associated with autosomal recessive spinocerebellar ataxia 12. Disruption of a similar gene in mouse results in impaired steroidogenesis, additionally suggesting a metabolic function for the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene results in premature death and increased incidence of tumor development. Reduced male fertility and testicular atrophy are also observed in mice with a hypomorphic allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Other mutations in Wwox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Wwox APN 8 115,172,118 (GRCm39) nonsense probably null
IGL02156:Wwox APN 8 115,174,899 (GRCm39) critical splice acceptor site probably null
IGL02267:Wwox APN 8 115,438,805 (GRCm39) missense probably benign 0.23
IGL02346:Wwox APN 8 115,438,858 (GRCm39) missense probably benign 0.11
IGL02350:Wwox APN 8 115,438,882 (GRCm39) missense possibly damaging 0.81
IGL02357:Wwox APN 8 115,438,882 (GRCm39) missense possibly damaging 0.81
IGL02586:Wwox APN 8 115,438,947 (GRCm39) missense possibly damaging 0.59
IGL02701:Wwox APN 8 115,433,108 (GRCm39) missense probably damaging 1.00
IGL02743:Wwox APN 8 116,078,443 (GRCm39) missense probably damaging 1.00
IGL02804:Wwox APN 8 115,438,753 (GRCm39) missense probably damaging 1.00
IGL02805:Wwox APN 8 115,438,753 (GRCm39) missense probably damaging 1.00
R0048:Wwox UTSW 8 115,166,570 (GRCm39) missense probably damaging 1.00
R0140:Wwox UTSW 8 115,433,027 (GRCm39) missense probably damaging 1.00
R0390:Wwox UTSW 8 115,433,018 (GRCm39) missense probably benign 0.08
R1146:Wwox UTSW 8 115,438,776 (GRCm39) missense probably damaging 1.00
R1146:Wwox UTSW 8 115,438,776 (GRCm39) missense probably damaging 1.00
R1193:Wwox UTSW 8 115,406,614 (GRCm39) missense probably benign
R1520:Wwox UTSW 8 115,438,873 (GRCm39) missense probably benign 0.36
R1552:Wwox UTSW 8 115,172,090 (GRCm39) nonsense probably null
R1628:Wwox UTSW 8 115,174,973 (GRCm39) missense probably benign
R1639:Wwox UTSW 8 115,172,118 (GRCm39) nonsense probably null
R3778:Wwox UTSW 8 115,601,347 (GRCm39) missense probably benign 0.00
R3967:Wwox UTSW 8 115,215,673 (GRCm39) missense probably damaging 1.00
R4077:Wwox UTSW 8 115,166,481 (GRCm39) utr 5 prime probably benign
R4876:Wwox UTSW 8 115,174,988 (GRCm39) missense probably damaging 1.00
R4936:Wwox UTSW 8 115,433,098 (GRCm39) missense probably benign 0.00
R5868:Wwox UTSW 8 115,406,586 (GRCm39) missense probably benign
R5988:Wwox UTSW 8 115,433,081 (GRCm39) missense probably benign 0.06
R6272:Wwox UTSW 8 115,215,692 (GRCm39) missense probably damaging 1.00
R7043:Wwox UTSW 8 115,406,578 (GRCm39) missense probably damaging 0.97
R7348:Wwox UTSW 8 115,199,392 (GRCm39) missense probably benign 0.00
R7815:Wwox UTSW 8 115,438,776 (GRCm39) missense probably damaging 1.00
R8119:Wwox UTSW 8 115,433,108 (GRCm39) missense probably damaging 1.00
R8544:Wwox UTSW 8 115,215,646 (GRCm39) missense probably benign 0.08
R9065:Wwox UTSW 8 115,215,682 (GRCm39) missense probably benign 0.05
R9183:Wwox UTSW 8 115,433,110 (GRCm39) missense probably damaging 1.00
R9187:Wwox UTSW 8 115,438,978 (GRCm39) missense probably damaging 0.97
R9525:Wwox UTSW 8 115,433,105 (GRCm39) missense probably benign 0.11
R9640:Wwox UTSW 8 115,166,540 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GTGCTGTCTACTGTCCACTGAC -3'
(R):5'- ACTGGCGGTGAACGGTAAAC -3'

Sequencing Primer
(F):5'- ACTGACATGTCCCTTCGTGAC -3'
(R):5'- GTAAACAAACGCATGGGTAATAACC -3'
Posted On 2020-09-02