Incidental Mutation 'R8324:Mmp13'
ID 643991
Institutional Source Beutler Lab
Gene Symbol Mmp13
Ensembl Gene ENSMUSG00000050578
Gene Name matrix metallopeptidase 13
Synonyms interstitial collagenase, Collagenase-3, collagenase-1, MMP-13, Mmp1, Clg
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.206) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 7272514-7283331 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 7276636 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 244 (I244F)
Ref Sequence ENSEMBL: ENSMUSP00000015394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015394]
AlphaFold P33435
PDB Structure STRUCTURE OF RECOMBINANT MOUSE COLLAGENASE-3 (MMP-13) [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015394
AA Change: I244F

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000015394
Gene: ENSMUSG00000050578
AA Change: I244F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:PG_binding_1 33 92 5.3e-13 PFAM
ZnMc 110 269 3.76e-59 SMART
HX 291 333 9.62e-8 SMART
HX 335 378 9.91e-10 SMART
HX 383 430 2.52e-11 SMART
HX 432 472 1.81e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family that plays a role in wound healing, skeletal development and bone remodeling. The encoded protein is activated by the removal of an N-terminal activation peptide to generate a zinc-dependent endopeptidase enzyme that can cleave various native collagens, including types I - IV, X and XIV. Mice lacking the encoded protein display profound defects in growth plate cartilage as well as a delay in the endochondral bone development. Lack of the encoded protein also impairs the wound healing process due to reduced keratinocyte migration and vascular density at the wound site. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Jun 2015]
PHENOTYPE: Homozygous null mice display increased width of hypertrophic chondrocyte zone and increased trabecular bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Mmp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Mmp13 APN 9 7,278,974 (GRCm39) splice site probably benign
IGL02027:Mmp13 APN 9 7,272,955 (GRCm39) missense probably damaging 1.00
IGL02320:Mmp13 APN 9 7,278,941 (GRCm39) missense probably benign 0.00
R0143:Mmp13 UTSW 9 7,276,558 (GRCm39) missense probably damaging 1.00
R0417:Mmp13 UTSW 9 7,276,602 (GRCm39) missense probably benign
R0505:Mmp13 UTSW 9 7,272,929 (GRCm39) missense probably damaging 1.00
R0624:Mmp13 UTSW 9 7,280,221 (GRCm39) missense possibly damaging 0.69
R0632:Mmp13 UTSW 9 7,282,077 (GRCm39) missense possibly damaging 0.74
R0632:Mmp13 UTSW 9 7,274,032 (GRCm39) missense probably damaging 1.00
R1102:Mmp13 UTSW 9 7,272,952 (GRCm39) missense possibly damaging 0.55
R1387:Mmp13 UTSW 9 7,282,033 (GRCm39) missense possibly damaging 0.60
R1478:Mmp13 UTSW 9 7,272,892 (GRCm39) missense probably damaging 1.00
R1669:Mmp13 UTSW 9 7,277,926 (GRCm39) missense probably benign 0.01
R4647:Mmp13 UTSW 9 7,274,233 (GRCm39) missense probably damaging 1.00
R4648:Mmp13 UTSW 9 7,274,233 (GRCm39) missense probably damaging 1.00
R4668:Mmp13 UTSW 9 7,272,580 (GRCm39) missense possibly damaging 0.54
R4827:Mmp13 UTSW 9 7,278,880 (GRCm39) missense possibly damaging 0.68
R4898:Mmp13 UTSW 9 7,272,953 (GRCm39) missense probably benign 0.10
R5780:Mmp13 UTSW 9 7,278,952 (GRCm39) missense possibly damaging 0.76
R5946:Mmp13 UTSW 9 7,276,580 (GRCm39) missense probably damaging 1.00
R5996:Mmp13 UTSW 9 7,274,269 (GRCm39) missense probably damaging 1.00
R6102:Mmp13 UTSW 9 7,276,688 (GRCm39) missense probably benign 0.07
R6693:Mmp13 UTSW 9 7,280,245 (GRCm39) missense probably benign 0.00
R6789:Mmp13 UTSW 9 7,272,781 (GRCm39) missense probably benign 0.00
R7310:Mmp13 UTSW 9 7,280,880 (GRCm39) missense possibly damaging 0.60
R7728:Mmp13 UTSW 9 7,274,004 (GRCm39) missense probably benign
R8041:Mmp13 UTSW 9 7,280,865 (GRCm39) missense probably benign 0.13
R8314:Mmp13 UTSW 9 7,272,931 (GRCm39) missense probably damaging 1.00
R8684:Mmp13 UTSW 9 7,282,089 (GRCm39) missense possibly damaging 0.51
R8755:Mmp13 UTSW 9 7,277,996 (GRCm39) missense possibly damaging 0.51
R9365:Mmp13 UTSW 9 7,277,921 (GRCm39) missense probably benign 0.02
T0722:Mmp13 UTSW 9 7,280,857 (GRCm39) missense possibly damaging 0.67
Z1177:Mmp13 UTSW 9 7,280,200 (GRCm39) missense possibly damaging 0.89
Z1177:Mmp13 UTSW 9 7,277,953 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTACTGATCACTAGCTATAAGAG -3'
(R):5'- TCTACCCAGACAAGCAGTTTGC -3'

Sequencing Primer
(F):5'- TCACTAGCTATAAGAGTAAGATGCTG -3'
(R):5'- GCAGTTTGCTCTCTCATTTTGAAAAC -3'
Posted On 2020-09-02