Incidental Mutation 'R8324:Peak1'
ID 643992
Institutional Source Beutler Lab
Gene Symbol Peak1
Ensembl Gene ENSMUSG00000074305
Gene Name pseudopodium-enriched atypical kinase 1
Synonyms 1110049L02Rik, C230081A13Rik, NKF3 kinase family member
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.365) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 56108410-56325351 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 56114760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 1394 (W1394R)
Ref Sequence ENSEMBL: ENSMUSP00000109901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061552] [ENSMUST00000188142]
AlphaFold Q69Z38
Predicted Effect probably damaging
Transcript: ENSMUST00000061552
AA Change: W1394R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109901
Gene: ENSMUSG00000074305
AA Change: W1394R

DomainStartEndE-ValueType
low complexity region 247 259 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 845 856 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 932 948 N/A INTRINSIC
Pfam:Pkinase_Tyr 1437 1649 1.5e-6 PFAM
Pfam:Pkinase 1440 1651 2.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188142
AA Change: W364R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139985
Gene: ENSMUSG00000074305
AA Change: W364R

DomainStartEndE-ValueType
STYKc 288 622 5.5e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-receptor tyrosine kinase that is a member of the new kinase family three (NFK3) family. In migrating cells, the encoded protein is associated with the actin cytoskeleton and focal adhesions and promotes developing focal adhesion elongation. This protein may play a role in the regulation of cell migration, proliferation and cancer metastasis. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Peak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Peak1 APN 9 56,134,610 (GRCm39) missense probably damaging 1.00
IGL00544:Peak1 APN 9 56,167,262 (GRCm39) missense probably damaging 1.00
IGL01141:Peak1 APN 9 56,165,811 (GRCm39) missense probably benign 0.01
IGL01743:Peak1 APN 9 56,166,486 (GRCm39) missense probably damaging 1.00
IGL01781:Peak1 APN 9 56,167,349 (GRCm39) missense possibly damaging 0.92
IGL01885:Peak1 APN 9 56,167,388 (GRCm39) missense probably damaging 1.00
IGL01941:Peak1 APN 9 56,166,059 (GRCm39) missense probably damaging 1.00
IGL02455:Peak1 APN 9 56,134,757 (GRCm39) missense possibly damaging 0.89
IGL02719:Peak1 APN 9 56,134,490 (GRCm39) missense probably damaging 1.00
IGL03247:Peak1 APN 9 56,165,214 (GRCm39) missense probably damaging 1.00
IGL03259:Peak1 APN 9 56,167,251 (GRCm39) missense probably damaging 1.00
R0060:Peak1 UTSW 9 56,135,107 (GRCm39) missense probably damaging 1.00
R0087:Peak1 UTSW 9 56,165,609 (GRCm39) missense probably damaging 1.00
R0480:Peak1 UTSW 9 56,165,916 (GRCm39) missense probably benign 0.00
R0569:Peak1 UTSW 9 56,167,373 (GRCm39) missense probably damaging 1.00
R0605:Peak1 UTSW 9 56,134,382 (GRCm39) splice site probably benign
R0865:Peak1 UTSW 9 56,165,116 (GRCm39) missense probably benign 0.02
R1117:Peak1 UTSW 9 56,165,702 (GRCm39) missense probably benign 0.05
R1922:Peak1 UTSW 9 56,113,971 (GRCm39) missense probably damaging 1.00
R1959:Peak1 UTSW 9 56,114,073 (GRCm39) missense probably damaging 1.00
R2069:Peak1 UTSW 9 56,166,043 (GRCm39) missense probably damaging 1.00
R2083:Peak1 UTSW 9 56,166,233 (GRCm39) missense probably damaging 1.00
R2154:Peak1 UTSW 9 56,114,496 (GRCm39) missense probably damaging 1.00
R2407:Peak1 UTSW 9 56,166,510 (GRCm39) missense probably damaging 1.00
R3832:Peak1 UTSW 9 56,165,667 (GRCm39) missense probably benign
R3938:Peak1 UTSW 9 56,167,649 (GRCm39) missense probably benign 0.01
R3964:Peak1 UTSW 9 56,167,263 (GRCm39) missense probably damaging 1.00
R4192:Peak1 UTSW 9 56,166,025 (GRCm39) missense probably damaging 1.00
R4381:Peak1 UTSW 9 56,165,711 (GRCm39) missense probably benign 0.34
R4869:Peak1 UTSW 9 56,134,876 (GRCm39) missense probably benign 0.06
R4994:Peak1 UTSW 9 56,148,560 (GRCm39) missense possibly damaging 0.65
R5062:Peak1 UTSW 9 56,167,573 (GRCm39) missense probably damaging 1.00
R5435:Peak1 UTSW 9 56,113,770 (GRCm39) missense probably damaging 0.98
R5632:Peak1 UTSW 9 56,165,058 (GRCm39) missense probably damaging 1.00
R5643:Peak1 UTSW 9 56,166,039 (GRCm39) missense probably damaging 0.99
R5880:Peak1 UTSW 9 56,114,894 (GRCm39) missense probably damaging 1.00
R5898:Peak1 UTSW 9 56,114,622 (GRCm39) missense probably benign 0.19
R5986:Peak1 UTSW 9 56,166,726 (GRCm39) missense probably benign 0.00
R6109:Peak1 UTSW 9 56,166,567 (GRCm39) missense probably benign 0.01
R6284:Peak1 UTSW 9 56,167,580 (GRCm39) missense probably benign 0.10
R6347:Peak1 UTSW 9 56,165,495 (GRCm39) missense probably benign 0.00
R6374:Peak1 UTSW 9 56,164,950 (GRCm39) missense probably damaging 1.00
R6471:Peak1 UTSW 9 56,165,543 (GRCm39) missense probably damaging 1.00
R6717:Peak1 UTSW 9 56,114,523 (GRCm39) missense probably benign 0.00
R7033:Peak1 UTSW 9 56,166,991 (GRCm39) missense probably damaging 1.00
R7039:Peak1 UTSW 9 56,165,093 (GRCm39) missense probably benign 0.01
R7100:Peak1 UTSW 9 56,166,677 (GRCm39) missense probably damaging 1.00
R7604:Peak1 UTSW 9 56,148,491 (GRCm39) nonsense probably null
R7868:Peak1 UTSW 9 56,167,754 (GRCm39) missense probably damaging 1.00
R7979:Peak1 UTSW 9 56,114,676 (GRCm39) missense possibly damaging 0.52
R8258:Peak1 UTSW 9 56,166,677 (GRCm39) missense probably damaging 1.00
R8259:Peak1 UTSW 9 56,166,677 (GRCm39) missense probably damaging 1.00
R8272:Peak1 UTSW 9 56,166,182 (GRCm39) missense probably damaging 1.00
R8516:Peak1 UTSW 9 56,167,284 (GRCm39) missense probably damaging 1.00
R8847:Peak1 UTSW 9 56,114,427 (GRCm39) missense probably damaging 1.00
R8895:Peak1 UTSW 9 56,113,938 (GRCm39) missense probably benign
R9082:Peak1 UTSW 9 56,165,504 (GRCm39) missense probably benign 0.07
R9138:Peak1 UTSW 9 56,164,925 (GRCm39) missense probably benign 0.34
R9355:Peak1 UTSW 9 56,167,454 (GRCm39) missense probably damaging 1.00
R9548:Peak1 UTSW 9 56,113,917 (GRCm39) missense probably benign 0.19
R9591:Peak1 UTSW 9 56,166,834 (GRCm39) missense possibly damaging 0.48
R9642:Peak1 UTSW 9 56,167,205 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATGGGCCAAAGAATCTCG -3'
(R):5'- GAAGTCTAAGTGTGCCTCCTG -3'

Sequencing Primer
(F):5'- AATCTCGCACGAAGTCGG -3'
(R):5'- GCTCTCTTTCAGATCTGCAAGAG -3'
Posted On 2020-09-02