Incidental Mutation 'R8324:Col6a6'
ID 643993
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Name collagen, type VI, alpha 6
Synonyms E330026B02Rik
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 105566616-105705413 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105632853 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1470 (E1470D)
Ref Sequence ENSEMBL: ENSMUSP00000096040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098441] [ENSMUST00000166431]
AlphaFold Q8C6K9
Predicted Effect probably benign
Transcript: ENSMUST00000098441
AA Change: E1470D

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: E1470D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166431
AA Change: E1470D

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: E1470D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105,635,390 (GRCm39) critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105,659,611 (GRCm39) missense probably benign 0.04
IGL00917:Col6a6 APN 9 105,661,453 (GRCm39) splice site probably benign
IGL01385:Col6a6 APN 9 105,660,865 (GRCm39) missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105,663,157 (GRCm39) nonsense probably null
IGL01508:Col6a6 APN 9 105,604,365 (GRCm39) splice site probably benign
IGL01668:Col6a6 APN 9 105,586,470 (GRCm39) missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105,586,454 (GRCm39) missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105,566,825 (GRCm39) missense probably benign 0.02
IGL01934:Col6a6 APN 9 105,575,858 (GRCm39) critical splice donor site probably null
IGL01944:Col6a6 APN 9 105,661,108 (GRCm39) missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105,658,184 (GRCm39) missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105,644,398 (GRCm39) critical splice donor site probably null
IGL02129:Col6a6 APN 9 105,613,539 (GRCm39) splice site probably benign
IGL02201:Col6a6 APN 9 105,658,194 (GRCm39) missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105,661,300 (GRCm39) missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105,609,415 (GRCm39) missense probably benign 0.05
IGL02574:Col6a6 APN 9 105,659,390 (GRCm39) missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105,604,369 (GRCm39) critical splice donor site probably null
IGL02852:Col6a6 APN 9 105,661,272 (GRCm39) missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105,586,651 (GRCm39) missense probably benign 0.01
IGL03327:Col6a6 APN 9 105,644,433 (GRCm39) missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105,609,462 (GRCm39) missense probably benign 0.23
R0042:Col6a6 UTSW 9 105,657,896 (GRCm39) missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105,626,047 (GRCm39) splice site probably benign
R0066:Col6a6 UTSW 9 105,579,412 (GRCm39) missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105,579,412 (GRCm39) missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105,579,474 (GRCm39) missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105,644,487 (GRCm39) missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105,661,315 (GRCm39) missense probably benign 0.13
R0382:Col6a6 UTSW 9 105,632,754 (GRCm39) missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105,661,403 (GRCm39) missense probably benign 0.02
R0421:Col6a6 UTSW 9 105,661,405 (GRCm39) missense probably benign 0.02
R0502:Col6a6 UTSW 9 105,644,550 (GRCm39) missense probably benign 0.04
R0503:Col6a6 UTSW 9 105,644,550 (GRCm39) missense probably benign 0.04
R0600:Col6a6 UTSW 9 105,638,639 (GRCm39) missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105,654,943 (GRCm39) missense probably benign 0.45
R0629:Col6a6 UTSW 9 105,604,364 (GRCm39) splice site probably benign
R0690:Col6a6 UTSW 9 105,586,685 (GRCm39) missense probably benign 0.01
R1155:Col6a6 UTSW 9 105,659,289 (GRCm39) missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105,626,109 (GRCm39) missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105,651,502 (GRCm39) missense probably null 0.98
R1263:Col6a6 UTSW 9 105,586,688 (GRCm39) missense probably benign 0.01
R1296:Col6a6 UTSW 9 105,658,290 (GRCm39) missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105,586,672 (GRCm39) missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105,655,274 (GRCm39) missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105,654,748 (GRCm39) missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105,609,410 (GRCm39) critical splice donor site probably null
R1830:Col6a6 UTSW 9 105,579,469 (GRCm39) missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105,658,301 (GRCm39) missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105,662,943 (GRCm39) missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105,586,583 (GRCm39) missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105,632,893 (GRCm39) missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105,658,003 (GRCm39) missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105,631,422 (GRCm39) missense probably benign 0.01
R3176:Col6a6 UTSW 9 105,663,429 (GRCm39) missense probably benign 0.01
R3276:Col6a6 UTSW 9 105,663,429 (GRCm39) missense probably benign 0.01
R3429:Col6a6 UTSW 9 105,655,166 (GRCm39) missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105,659,373 (GRCm39) missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105,657,891 (GRCm39) missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105,576,078 (GRCm39) missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105,661,155 (GRCm39) missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105,660,889 (GRCm39) missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105,576,148 (GRCm39) missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105,644,541 (GRCm39) missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105,644,623 (GRCm39) missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105,666,147 (GRCm39) missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105,644,397 (GRCm39) critical splice donor site probably null
R5002:Col6a6 UTSW 9 105,663,292 (GRCm39) missense probably benign 0.00
R5111:Col6a6 UTSW 9 105,586,673 (GRCm39) missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105,659,232 (GRCm39) missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105,586,306 (GRCm39) missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105,651,537 (GRCm39) missense probably null 0.79
R5491:Col6a6 UTSW 9 105,615,435 (GRCm39) missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105,638,717 (GRCm39) critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105,644,274 (GRCm39) missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105,661,116 (GRCm39) missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105,604,426 (GRCm39) splice site probably null
R6425:Col6a6 UTSW 9 105,576,064 (GRCm39) missense probably benign 0.21
R6464:Col6a6 UTSW 9 105,666,152 (GRCm39) start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105,575,890 (GRCm39) missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105,663,024 (GRCm39) missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105,576,112 (GRCm39) missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105,660,879 (GRCm39) missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105,661,140 (GRCm39) missense probably benign 0.32
R7032:Col6a6 UTSW 9 105,644,707 (GRCm39) missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105,661,168 (GRCm39) missense probably benign 0.00
R7472:Col6a6 UTSW 9 105,659,622 (GRCm39) missense probably damaging 1.00
R7541:Col6a6 UTSW 9 105,644,523 (GRCm39) missense probably damaging 1.00
R7640:Col6a6 UTSW 9 105,662,943 (GRCm39) missense possibly damaging 0.74
R7645:Col6a6 UTSW 9 105,644,397 (GRCm39) critical splice donor site probably null
R7716:Col6a6 UTSW 9 105,661,102 (GRCm39) missense possibly damaging 0.84
R7866:Col6a6 UTSW 9 105,566,760 (GRCm39) missense probably damaging 0.96
R7938:Col6a6 UTSW 9 105,657,883 (GRCm39) nonsense probably null
R8016:Col6a6 UTSW 9 105,644,727 (GRCm39) missense possibly damaging 0.73
R8043:Col6a6 UTSW 9 105,576,219 (GRCm39) missense probably damaging 0.98
R8073:Col6a6 UTSW 9 105,659,146 (GRCm39) missense probably benign 0.01
R8082:Col6a6 UTSW 9 105,661,129 (GRCm39) nonsense probably null
R8243:Col6a6 UTSW 9 105,576,468 (GRCm39) missense probably damaging 1.00
R8306:Col6a6 UTSW 9 105,661,272 (GRCm39) missense probably damaging 0.96
R8384:Col6a6 UTSW 9 105,632,893 (GRCm39) missense probably damaging 1.00
R8400:Col6a6 UTSW 9 105,651,995 (GRCm39) missense probably damaging 1.00
R8523:Col6a6 UTSW 9 105,651,987 (GRCm39) missense possibly damaging 0.71
R8842:Col6a6 UTSW 9 105,655,166 (GRCm39) missense probably damaging 1.00
R8862:Col6a6 UTSW 9 105,663,348 (GRCm39) missense probably damaging 1.00
R8907:Col6a6 UTSW 9 105,644,528 (GRCm39) missense probably damaging 0.99
R9021:Col6a6 UTSW 9 105,586,745 (GRCm39) missense possibly damaging 0.85
R9088:Col6a6 UTSW 9 105,661,276 (GRCm39) missense probably damaging 0.99
R9178:Col6a6 UTSW 9 105,659,169 (GRCm39) missense probably benign 0.30
R9225:Col6a6 UTSW 9 105,659,437 (GRCm39) missense possibly damaging 0.75
R9340:Col6a6 UTSW 9 105,651,757 (GRCm39) missense probably damaging 1.00
R9342:Col6a6 UTSW 9 105,663,172 (GRCm39) missense probably benign 0.00
R9360:Col6a6 UTSW 9 105,644,686 (GRCm39) missense probably benign 0.00
R9368:Col6a6 UTSW 9 105,663,300 (GRCm39) missense possibly damaging 0.48
R9398:Col6a6 UTSW 9 105,651,825 (GRCm39) missense probably benign 0.40
R9450:Col6a6 UTSW 9 105,661,373 (GRCm39) missense probably benign
R9454:Col6a6 UTSW 9 105,661,059 (GRCm39) missense probably damaging 0.99
R9458:Col6a6 UTSW 9 105,586,361 (GRCm39) missense probably benign 0.01
R9563:Col6a6 UTSW 9 105,572,952 (GRCm39) missense probably benign 0.02
R9568:Col6a6 UTSW 9 105,657,926 (GRCm39) missense possibly damaging 0.58
R9613:Col6a6 UTSW 9 105,616,401 (GRCm39) missense probably benign 0.07
R9664:Col6a6 UTSW 9 105,658,254 (GRCm39) missense probably benign 0.11
R9747:Col6a6 UTSW 9 105,661,239 (GRCm39) missense probably benign 0.29
R9760:Col6a6 UTSW 9 105,659,253 (GRCm39) missense probably damaging 0.99
X0022:Col6a6 UTSW 9 105,576,531 (GRCm39) missense probably damaging 1.00
Z1176:Col6a6 UTSW 9 105,658,151 (GRCm39) missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105,666,094 (GRCm39) missense probably null 0.24
Z1177:Col6a6 UTSW 9 105,605,454 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGCAAGTCTAAGGCAGTTG -3'
(R):5'- TCAACATTACCCAGGCATCG -3'

Sequencing Primer
(F):5'- CTATGCAGACTCATAGTTTCTGTG -3'
(R):5'- GATGCGCTCTGTGTTCTA -3'
Posted On 2020-09-02