Mutagenetix > Incidental Mutation

Incidental Mutation 'R8324:Col6a6'

643993

Institutional Source

Beutler Lab

Gene Symbol

Col6a6

Ensembl Gene

ENSMUSG00000043719

Gene Name

collagen, type VI, alpha 6

Synonyms

E330026B02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R8324 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105687809-105828160 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 105755654 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 1470 (E1470D)

Ref Sequence

ENSEMBL: ENSMUSP00000096040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098441] [ENSMUST00000166431]

AlphaFold

Q8C6K9

Predicted Effect

probably benign
Transcript: ENSMUST00000098441
AA Change: E1470D

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: E1470D

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	3.3e-9	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166431
AA Change: E1470D

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: E1470D

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	9.3e-10	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,290,395	S753P	probably damaging	Het
Acan	A	G	7: 79,091,056	E390G	probably damaging	Het
Antxr2	T	C	5: 97,938,509	N413S	probably damaging	Het
Bace2	C	T	16: 97,356,908	A36V	possibly damaging	Het
Caprin1	G	A	2: 103,783,181	R79*	probably null	Het
Cdan1	A	G	2: 120,727,325	V507A	probably benign	Het
Cdkl3	T	A	11: 52,022,879		probably null	Het
Chst5	A	T	8: 111,890,508	L160Q	probably benign	Het
Col11a1	C	G	3: 114,164,410	P1111R	probably damaging	Het
Cpped1	T	A	16: 11,805,476	T274S	probably benign	Het
Ctnnbl1	G	A	2: 157,779,815	E75K	probably damaging	Het
Cyp4f40	T	C	17: 32,659,528	S15P	probably benign	Het
Ddx46	T	C	13: 55,663,914	S643P	probably damaging	Het
Defb34	A	G	8: 19,123,798	Q16R	probably null	Het
Dhrs2	T	A	14: 55,238,764	V147E	probably damaging	Het
Dnah5	G	T	15: 28,346,865	R2498L	probably damaging	Het
Dpp10	T	A	1: 123,854,172	I93F	probably benign	Het
Eef1e1	T	A	13: 38,655,069	D104V	probably damaging	Het
Egfr	A	G	11: 16,858,971	Y55C	probably damaging	Het
Egfr	A	C	11: 16,908,885	I955L	probably damaging	Het
Ehbp1l1	C	A	19: 5,719,998	V426F	possibly damaging	Het
Fam234a	C	T	17: 26,218,698	V108I	probably benign	Het
Fzd8	T	A	18: 9,214,688	M590K	probably damaging	Het
Gm13287	T	C	4: 88,803,638	S129P	probably damaging	Het
Heatr5b	A	G	17: 78,755,364	S1919P	possibly damaging	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Ikbkap	C	T	4: 56,772,491	E877K	probably damaging	Het
Itpr2	T	C	6: 146,328,398	E1233G	probably damaging	Het
Kcnmb4	A	G	10: 116,418,314	L186P	probably damaging	Het
Krt72	T	A	15: 101,782,145	Y224F	probably damaging	Het
Loxhd1	T	C	18: 77,339,579		probably null	Het
Lrguk	A	G	6: 34,102,571	T914A	probably benign	Het
Lrrtm4	A	G	6: 80,021,991	T129A	probably damaging	Het
Mmp13	A	T	9: 7,276,636	I244F	possibly damaging	Het
Mob1a	T	A	6: 83,329,974	L41Q	probably damaging	Het
Mtcl1	T	C	17: 66,436,217	R426G	probably damaging	Het
Mybbp1a	T	C	11: 72,445,288		probably null	Het
Myh9	A	G	15: 77,788,917		probably null	Het
Myo1d	T	A	11: 80,557,521	D926V	probably damaging	Het
Ncapg	T	G	5: 45,695,668	H825Q	probably damaging	Het
Olfml1	T	C	7: 107,590,363	S212P	probably benign	Het
Olfr656	G	A	7: 104,618,114	R145H	probably benign	Het
Pak2	T	C	16: 32,052,211	N51S	probably benign	Het
Papln	T	C	12: 83,786,619	Y1132H	probably damaging	Het
Pax3	T	A	1: 78,193,789	R134S	probably damaging	Het
Pdzrn4	A	G	15: 92,770,937	E990G	probably damaging	Het
Peak1	A	T	9: 56,207,476	W1394R	probably damaging	Het
Pkn2	T	C	3: 142,829,010	N285D	probably benign	Het
Pramef12	A	C	4: 144,395,857	L39R	probably damaging	Het
Prrc2a	A	G	17: 35,156,984	S897P	possibly damaging	Het
Rad51	A	G	2: 119,123,831	T131A	possibly damaging	Het
Rc3h2	T	A	2: 37,400,726	T255S	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rictor	T	A	15: 6,745,562	V125E	probably damaging	Het
Rps6ka5	C	T	12: 100,558,487	D664N	possibly damaging	Het
Rreb1	T	A	13: 37,947,621	W1584R	probably damaging	Het
Rxra	T	C	2: 27,741,183	I142T	probably damaging	Het
Sall2	T	C	14: 52,312,886	T951A	probably benign	Het
Slc15a2	T	G	16: 36,759,307	N359T	probably damaging	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Slc6a13	T	C	6: 121,337,414	*603Q	probably null	Het
Sptb	T	C	12: 76,619,162	D894G	possibly damaging	Het
Srgn	A	G	10: 62,507,665	L17P	probably damaging	Het
Tmprss9	T	C	10: 80,897,371		probably null	Het
Trav9n-4	T	C	14: 53,294,946	F86L	probably benign	Het
Trp63	A	G	16: 25,876,734	Y482C	unknown	Het
Ttc9b	G	T	7: 27,653,969	A15S	probably damaging	Het
Urb1	A	T	16: 90,791,190	I410N	probably damaging	Het
Vmn2r82	A	T	10: 79,378,893	K237*	probably null	Het
Wwox	G	A	8: 114,489,005		probably null	Het

Other mutations in Col6a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Col6a6	APN	9	105758191	critical splice acceptor site	probably null
IGL00768:Col6a6	APN	9	105782412	missense	probably benign	0.04
IGL00917:Col6a6	APN	9	105784254	splice site	probably benign
IGL01385:Col6a6	APN	9	105783666	missense	probably damaging	1.00
IGL01411:Col6a6	APN	9	105785958	nonsense	probably null
IGL01508:Col6a6	APN	9	105727166	splice site	probably benign
IGL01668:Col6a6	APN	9	105709271	missense	probably damaging	1.00
IGL01733:Col6a6	APN	9	105709255	missense	possibly damaging	0.92
IGL01932:Col6a6	APN	9	105689626	missense	probably benign	0.02
IGL01934:Col6a6	APN	9	105698659	critical splice donor site	probably null
IGL01944:Col6a6	APN	9	105783909	missense	probably damaging	1.00
IGL01980:Col6a6	APN	9	105780985	missense	probably damaging	0.96
IGL02114:Col6a6	APN	9	105767199	critical splice donor site	probably null
IGL02129:Col6a6	APN	9	105736340	splice site	probably benign
IGL02201:Col6a6	APN	9	105780995	missense	probably damaging	1.00
IGL02335:Col6a6	APN	9	105784101	missense	probably damaging	1.00
IGL02541:Col6a6	APN	9	105732216	missense	probably benign	0.05
IGL02574:Col6a6	APN	9	105782191	missense	probably damaging	1.00
IGL02649:Col6a6	APN	9	105727170	critical splice donor site	probably null
IGL02852:Col6a6	APN	9	105784073	missense	probably damaging	0.99
IGL03278:Col6a6	APN	9	105709452	missense	probably benign	0.01
IGL03327:Col6a6	APN	9	105767234	missense	possibly damaging	0.90
PIT4519001:Col6a6	UTSW	9	105732263	missense	probably benign	0.23
R0042:Col6a6	UTSW	9	105780697	missense	possibly damaging	0.89
R0046:Col6a6	UTSW	9	105748848	splice site	probably benign
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0140:Col6a6	UTSW	9	105702275	missense	probably damaging	1.00
R0278:Col6a6	UTSW	9	105767288	missense	possibly damaging	0.87
R0281:Col6a6	UTSW	9	105784116	missense	probably benign	0.13
R0382:Col6a6	UTSW	9	105755555	missense	probably damaging	0.98
R0389:Col6a6	UTSW	9	105784204	missense	probably benign	0.02
R0421:Col6a6	UTSW	9	105784206	missense	probably benign	0.02
R0502:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0503:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0600:Col6a6	UTSW	9	105761440	missense	probably damaging	1.00
R0626:Col6a6	UTSW	9	105777744	missense	probably benign	0.45
R0629:Col6a6	UTSW	9	105727165	splice site	probably benign
R0690:Col6a6	UTSW	9	105709486	missense	probably benign	0.01
R1155:Col6a6	UTSW	9	105782090	missense	possibly damaging	0.64
R1245:Col6a6	UTSW	9	105748910	missense	possibly damaging	0.62
R1253:Col6a6	UTSW	9	105774303	missense	probably null	0.98
R1263:Col6a6	UTSW	9	105709489	missense	probably benign	0.01
R1296:Col6a6	UTSW	9	105781091	missense	probably damaging	1.00
R1556:Col6a6	UTSW	9	105709473	missense	possibly damaging	0.82
R1600:Col6a6	UTSW	9	105778075	missense	probably damaging	1.00
R1612:Col6a6	UTSW	9	105777549	missense	probably damaging	1.00
R1613:Col6a6	UTSW	9	105732211	critical splice donor site	probably null
R1830:Col6a6	UTSW	9	105702270	missense	probably damaging	0.99
R1858:Col6a6	UTSW	9	105781102	missense	probably damaging	1.00
R1897:Col6a6	UTSW	9	105785744	missense	possibly damaging	0.74
R1944:Col6a6	UTSW	9	105709384	missense	probably damaging	1.00
R2366:Col6a6	UTSW	9	105755694	missense	probably damaging	1.00
R2484:Col6a6	UTSW	9	105780804	missense	probably damaging	0.98
R3079:Col6a6	UTSW	9	105754223	missense	probably benign	0.01
R3176:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3276:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3429:Col6a6	UTSW	9	105777967	missense	probably damaging	1.00
R3716:Col6a6	UTSW	9	105782174	missense	probably damaging	0.98
R3809:Col6a6	UTSW	9	105780692	missense	probably damaging	1.00
R3978:Col6a6	UTSW	9	105698879	missense	probably damaging	0.98
R4087:Col6a6	UTSW	9	105783956	missense	possibly damaging	0.68
R4382:Col6a6	UTSW	9	105783690	missense	probably damaging	1.00
R4516:Col6a6	UTSW	9	105698949	missense	possibly damaging	0.64
R4666:Col6a6	UTSW	9	105767342	missense	possibly damaging	0.93
R4905:Col6a6	UTSW	9	105767424	missense	probably damaging	1.00
R4923:Col6a6	UTSW	9	105788948	missense	probably damaging	1.00
R4951:Col6a6	UTSW	9	105767198	critical splice donor site	probably null
R5002:Col6a6	UTSW	9	105786093	missense	probably benign	0.00
R5111:Col6a6	UTSW	9	105709474	missense	possibly damaging	0.70
R5205:Col6a6	UTSW	9	105782033	missense	probably damaging	0.99
R5399:Col6a6	UTSW	9	105709107	missense	possibly damaging	0.50
R5475:Col6a6	UTSW	9	105774338	missense	probably null	0.79
R5491:Col6a6	UTSW	9	105738236	missense	probably damaging	0.98
R5758:Col6a6	UTSW	9	105761518	critical splice acceptor site	probably null
R5934:Col6a6	UTSW	9	105767075	missense	probably damaging	1.00
R6059:Col6a6	UTSW	9	105783917	missense	probably damaging	1.00
R6284:Col6a6	UTSW	9	105727227	splice site	probably null
R6425:Col6a6	UTSW	9	105698865	missense	probably benign	0.21
R6464:Col6a6	UTSW	9	105788953	start codon destroyed	probably null	0.60
R6469:Col6a6	UTSW	9	105698691	missense	probably damaging	0.97
R6520:Col6a6	UTSW	9	105785825	missense	possibly damaging	0.89
R6552:Col6a6	UTSW	9	105698913	missense	probably damaging	1.00
R6750:Col6a6	UTSW	9	105783680	missense	probably damaging	1.00
R6813:Col6a6	UTSW	9	105783941	missense	probably benign	0.32
R7032:Col6a6	UTSW	9	105767508	missense	probably damaging	0.96
R7260:Col6a6	UTSW	9	105783969	missense	probably benign	0.00
R7472:Col6a6	UTSW	9	105782423	missense	probably damaging	1.00
R7541:Col6a6	UTSW	9	105767324	missense	probably damaging	1.00
R7640:Col6a6	UTSW	9	105785744	missense	possibly damaging	0.74
R7645:Col6a6	UTSW	9	105767198	critical splice donor site	probably null
R7716:Col6a6	UTSW	9	105783903	missense	possibly damaging	0.84
R7866:Col6a6	UTSW	9	105689561	missense	probably damaging	0.96
R7938:Col6a6	UTSW	9	105780684	nonsense	probably null
R8016:Col6a6	UTSW	9	105767528	missense	possibly damaging	0.73
R8043:Col6a6	UTSW	9	105699020	missense	probably damaging	0.98
R8073:Col6a6	UTSW	9	105781947	missense	probably benign	0.01
R8082:Col6a6	UTSW	9	105783930	nonsense	probably null
R8243:Col6a6	UTSW	9	105699269	missense	probably damaging	1.00
R8306:Col6a6	UTSW	9	105784073	missense	probably damaging	0.96
R8384:Col6a6	UTSW	9	105755694	missense	probably damaging	1.00
R8400:Col6a6	UTSW	9	105774796	missense	probably damaging	1.00
R8523:Col6a6	UTSW	9	105774788	missense	possibly damaging	0.71
R8842:Col6a6	UTSW	9	105777967	missense	probably damaging	1.00
R8862:Col6a6	UTSW	9	105786149	missense	probably damaging	1.00
R8907:Col6a6	UTSW	9	105767329	missense	probably damaging	0.99
R9021:Col6a6	UTSW	9	105709546	missense	possibly damaging	0.85
R9088:Col6a6	UTSW	9	105784077	missense	probably damaging	0.99
R9178:Col6a6	UTSW	9	105781970	missense	probably benign	0.30
R9225:Col6a6	UTSW	9	105782238	missense	possibly damaging	0.75
R9340:Col6a6	UTSW	9	105774558	missense	probably damaging	1.00
R9342:Col6a6	UTSW	9	105785973	missense	probably benign	0.00
R9360:Col6a6	UTSW	9	105767487	missense	probably benign	0.00
R9368:Col6a6	UTSW	9	105786101	missense	possibly damaging	0.48
R9398:Col6a6	UTSW	9	105774626	missense	probably benign	0.40
R9450:Col6a6	UTSW	9	105784174	missense	probably benign
R9454:Col6a6	UTSW	9	105783860	missense	probably damaging	0.99
R9458:Col6a6	UTSW	9	105709162	missense	probably benign	0.01
R9563:Col6a6	UTSW	9	105695753	missense	probably benign	0.02
R9568:Col6a6	UTSW	9	105780727	missense	possibly damaging	0.58
R9613:Col6a6	UTSW	9	105739202	missense	probably benign	0.07
R9664:Col6a6	UTSW	9	105781055	missense	probably benign	0.11
R9747:Col6a6	UTSW	9	105784040	missense	probably benign	0.29
R9760:Col6a6	UTSW	9	105782054	missense	probably damaging	0.99
X0022:Col6a6	UTSW	9	105699332	missense	probably damaging	1.00
Z1176:Col6a6	UTSW	9	105780952	missense	probably damaging	1.00
Z1177:Col6a6	UTSW	9	105728255	missense	probably damaging	1.00
Z1177:Col6a6	UTSW	9	105788895	missense	probably null	0.24

Predicted Primers

PCR Primer
(F):5'- ATGAGCAAGTCTAAGGCAGTTG -3'
(R):5'- TCAACATTACCCAGGCATCG -3'

Sequencing Primer
(F):5'- CTATGCAGACTCATAGTTTCTGTG -3'
(R):5'- GATGCGCTCTGTGTTCTA -3'

Posted On

2020-09-02