Incidental Mutation 'R8324:Vmn2r82'
ID 643995
Institutional Source Beutler Lab
Gene Symbol Vmn2r82
Ensembl Gene ENSMUSG00000091468
Gene Name vomeronasal 2, receptor 82
Synonyms EG624845
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 79192425-79232600 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 79214727 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 237 (K237*)
Ref Sequence ENSEMBL: ENSMUSP00000130114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170596]
AlphaFold G3UWA2
Predicted Effect probably null
Transcript: ENSMUST00000170596
AA Change: K237*
SMART Domains Protein: ENSMUSP00000130114
Gene: ENSMUSG00000091468
AA Change: K237*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 79 474 6e-35 PFAM
Pfam:NCD3G 517 570 9.3e-22 PFAM
Pfam:7tm_3 603 838 6.5e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Vmn2r82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Vmn2r82 APN 10 79,192,581 (GRCm39) missense probably benign 0.03
IGL01860:Vmn2r82 APN 10 79,214,691 (GRCm39) missense probably benign 0.18
IGL01927:Vmn2r82 APN 10 79,213,906 (GRCm39) missense probably damaging 1.00
IGL01929:Vmn2r82 APN 10 79,214,545 (GRCm39) missense probably damaging 1.00
IGL02028:Vmn2r82 APN 10 79,215,057 (GRCm39) missense probably benign
IGL02112:Vmn2r82 APN 10 79,231,833 (GRCm39) missense probably benign 0.19
IGL02632:Vmn2r82 APN 10 79,192,542 (GRCm39) missense probably benign 0.45
IGL02665:Vmn2r82 APN 10 79,215,205 (GRCm39) missense probably damaging 0.99
IGL02716:Vmn2r82 APN 10 79,213,678 (GRCm39) missense probably benign 0.20
IGL03030:Vmn2r82 APN 10 79,217,149 (GRCm39) missense possibly damaging 0.85
IGL03190:Vmn2r82 APN 10 79,192,643 (GRCm39) splice site probably null
IGL03349:Vmn2r82 APN 10 79,213,703 (GRCm39) missense probably benign 0.25
IGL03048:Vmn2r82 UTSW 10 79,232,460 (GRCm39) missense probably damaging 0.98
R0080:Vmn2r82 UTSW 10 79,232,339 (GRCm39) missense probably benign 0.00
R0193:Vmn2r82 UTSW 10 79,217,129 (GRCm39) missense probably damaging 1.00
R0217:Vmn2r82 UTSW 10 79,214,634 (GRCm39) missense possibly damaging 0.46
R0285:Vmn2r82 UTSW 10 79,232,391 (GRCm39) missense probably damaging 1.00
R1193:Vmn2r82 UTSW 10 79,213,739 (GRCm39) nonsense probably null
R1385:Vmn2r82 UTSW 10 79,232,325 (GRCm39) nonsense probably null
R1386:Vmn2r82 UTSW 10 79,214,545 (GRCm39) missense probably damaging 1.00
R1442:Vmn2r82 UTSW 10 79,215,201 (GRCm39) missense probably benign 0.03
R1467:Vmn2r82 UTSW 10 79,232,133 (GRCm39) missense probably benign 0.00
R1467:Vmn2r82 UTSW 10 79,232,133 (GRCm39) missense probably benign 0.00
R1518:Vmn2r82 UTSW 10 79,214,702 (GRCm39) missense probably damaging 1.00
R1538:Vmn2r82 UTSW 10 79,192,578 (GRCm39) missense possibly damaging 0.92
R1607:Vmn2r82 UTSW 10 79,215,253 (GRCm39) missense possibly damaging 0.67
R1812:Vmn2r82 UTSW 10 79,215,046 (GRCm39) missense probably benign 0.33
R1906:Vmn2r82 UTSW 10 79,232,344 (GRCm39) missense probably damaging 1.00
R1954:Vmn2r82 UTSW 10 79,231,890 (GRCm39) missense probably damaging 1.00
R1972:Vmn2r82 UTSW 10 79,214,680 (GRCm39) missense probably damaging 1.00
R2093:Vmn2r82 UTSW 10 79,231,813 (GRCm39) missense probably benign 0.30
R2156:Vmn2r82 UTSW 10 79,214,722 (GRCm39) missense probably damaging 1.00
R2202:Vmn2r82 UTSW 10 79,192,519 (GRCm39) missense probably benign
R2442:Vmn2r82 UTSW 10 79,221,210 (GRCm39) missense probably damaging 1.00
R2444:Vmn2r82 UTSW 10 79,213,702 (GRCm39) missense possibly damaging 0.65
R2857:Vmn2r82 UTSW 10 79,217,090 (GRCm39) missense probably damaging 0.98
R2858:Vmn2r82 UTSW 10 79,217,090 (GRCm39) missense probably damaging 0.98
R2884:Vmn2r82 UTSW 10 79,232,082 (GRCm39) missense probably benign 0.00
R2886:Vmn2r82 UTSW 10 79,232,082 (GRCm39) missense probably benign 0.00
R4369:Vmn2r82 UTSW 10 79,231,914 (GRCm39) missense probably benign 0.01
R4445:Vmn2r82 UTSW 10 79,214,874 (GRCm39) missense possibly damaging 0.87
R4589:Vmn2r82 UTSW 10 79,192,548 (GRCm39) missense probably damaging 1.00
R4703:Vmn2r82 UTSW 10 79,214,641 (GRCm39) missense probably damaging 1.00
R4908:Vmn2r82 UTSW 10 79,214,589 (GRCm39) missense probably benign 0.00
R4937:Vmn2r82 UTSW 10 79,215,010 (GRCm39) missense probably benign 0.01
R5199:Vmn2r82 UTSW 10 79,231,921 (GRCm39) missense probably damaging 1.00
R5391:Vmn2r82 UTSW 10 79,192,491 (GRCm39) missense probably null 0.01
R5601:Vmn2r82 UTSW 10 79,232,025 (GRCm39) missense probably damaging 1.00
R5635:Vmn2r82 UTSW 10 79,214,652 (GRCm39) missense probably benign 0.33
R6065:Vmn2r82 UTSW 10 79,221,210 (GRCm39) missense probably damaging 1.00
R6074:Vmn2r82 UTSW 10 79,232,377 (GRCm39) missense probably damaging 1.00
R6340:Vmn2r82 UTSW 10 79,231,727 (GRCm39) missense probably benign 0.00
R6474:Vmn2r82 UTSW 10 79,214,871 (GRCm39) missense possibly damaging 0.55
R6995:Vmn2r82 UTSW 10 79,232,377 (GRCm39) missense probably damaging 1.00
R7111:Vmn2r82 UTSW 10 79,214,605 (GRCm39) missense probably benign 0.22
R7212:Vmn2r82 UTSW 10 79,215,268 (GRCm39) missense probably benign 0.00
R7335:Vmn2r82 UTSW 10 79,214,722 (GRCm39) missense probably damaging 1.00
R7353:Vmn2r82 UTSW 10 79,232,452 (GRCm39) missense probably benign 0.11
R7354:Vmn2r82 UTSW 10 79,192,464 (GRCm39) missense probably benign 0.00
R7362:Vmn2r82 UTSW 10 79,232,451 (GRCm39) missense probably benign 0.00
R7378:Vmn2r82 UTSW 10 79,232,276 (GRCm39) nonsense probably null
R7430:Vmn2r82 UTSW 10 79,217,087 (GRCm39) missense probably damaging 1.00
R7509:Vmn2r82 UTSW 10 79,231,842 (GRCm39) missense possibly damaging 0.82
R7874:Vmn2r82 UTSW 10 79,232,345 (GRCm39) missense probably damaging 1.00
R7943:Vmn2r82 UTSW 10 79,232,079 (GRCm39) missense possibly damaging 0.74
R8158:Vmn2r82 UTSW 10 79,213,636 (GRCm39) missense probably benign 0.12
R8340:Vmn2r82 UTSW 10 79,217,036 (GRCm39) missense probably benign 0.00
R8787:Vmn2r82 UTSW 10 79,213,894 (GRCm39) missense probably damaging 1.00
R8929:Vmn2r82 UTSW 10 79,232,541 (GRCm39) missense probably benign 0.00
R9018:Vmn2r82 UTSW 10 79,232,539 (GRCm39) missense probably damaging 1.00
R9399:Vmn2r82 UTSW 10 79,214,768 (GRCm39) nonsense probably null
R9517:Vmn2r82 UTSW 10 79,213,641 (GRCm39) nonsense probably null
R9587:Vmn2r82 UTSW 10 79,214,936 (GRCm39) missense possibly damaging 0.70
R9602:Vmn2r82 UTSW 10 79,214,880 (GRCm39) missense probably benign 0.07
Z1088:Vmn2r82 UTSW 10 79,192,456 (GRCm39) missense probably damaging 1.00
Z1177:Vmn2r82 UTSW 10 79,232,369 (GRCm39) missense probably damaging 1.00
Z1177:Vmn2r82 UTSW 10 79,192,429 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCTGTTCAGATTGATAGAAACCAG -3'
(R):5'- GAGAGCCCCATGGGATAATTC -3'

Sequencing Primer
(F):5'- GAAACCAGTTTCGATCTCTCTACCAG -3'
(R):5'- ATATAGTTCTATATTGGGGCAAAACC -3'
Posted On 2020-09-02