Incidental Mutation 'R8324:Kcnmb4'
ID 643997
Institutional Source Beutler Lab
Gene Symbol Kcnmb4
Ensembl Gene ENSMUSG00000054934
Gene Name potassium large conductance calcium-activated channel, subfamily M, beta member 4
Synonyms 2900045G12Rik, Slowpoke beta 4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 116417861-116473878 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116418314 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 186 (L186P)
Ref Sequence ENSEMBL: ENSMUSP00000065384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068233]
AlphaFold Q9JIN6
Predicted Effect probably damaging
Transcript: ENSMUST00000068233
AA Change: L186P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065384
Gene: ENSMUSG00000054934
AA Change: L186P

DomainStartEndE-ValueType
Pfam:CaKB 8 203 2.7e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which slows activation kinetics, leads to steeper calcium sensitivity, and shifts the voltage range of current activation to more negative potentials than does the beta 1 subunit. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,290,395 S753P probably damaging Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Antxr2 T C 5: 97,938,509 N413S probably damaging Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
Caprin1 G A 2: 103,783,181 R79* probably null Het
Cdan1 A G 2: 120,727,325 V507A probably benign Het
Cdkl3 T A 11: 52,022,879 probably null Het
Chst5 A T 8: 111,890,508 L160Q probably benign Het
Col11a1 C G 3: 114,164,410 P1111R probably damaging Het
Col6a6 T A 9: 105,755,654 E1470D probably benign Het
Cpped1 T A 16: 11,805,476 T274S probably benign Het
Ctnnbl1 G A 2: 157,779,815 E75K probably damaging Het
Cyp4f40 T C 17: 32,659,528 S15P probably benign Het
Ddx46 T C 13: 55,663,914 S643P probably damaging Het
Defb34 A G 8: 19,123,798 Q16R probably null Het
Dhrs2 T A 14: 55,238,764 V147E probably damaging Het
Dnah5 G T 15: 28,346,865 R2498L probably damaging Het
Dpp10 T A 1: 123,854,172 I93F probably benign Het
Eef1e1 T A 13: 38,655,069 D104V probably damaging Het
Egfr A G 11: 16,858,971 Y55C probably damaging Het
Egfr A C 11: 16,908,885 I955L probably damaging Het
Ehbp1l1 C A 19: 5,719,998 V426F possibly damaging Het
Fam234a C T 17: 26,218,698 V108I probably benign Het
Fzd8 T A 18: 9,214,688 M590K probably damaging Het
Gm13287 T C 4: 88,803,638 S129P probably damaging Het
Heatr5b A G 17: 78,755,364 S1919P possibly damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ikbkap C T 4: 56,772,491 E877K probably damaging Het
Itpr2 T C 6: 146,328,398 E1233G probably damaging Het
Krt72 T A 15: 101,782,145 Y224F probably damaging Het
Loxhd1 T C 18: 77,339,579 probably null Het
Lrguk A G 6: 34,102,571 T914A probably benign Het
Lrrtm4 A G 6: 80,021,991 T129A probably damaging Het
Mmp13 A T 9: 7,276,636 I244F possibly damaging Het
Mob1a T A 6: 83,329,974 L41Q probably damaging Het
Mtcl1 T C 17: 66,436,217 R426G probably damaging Het
Mybbp1a T C 11: 72,445,288 probably null Het
Myh9 A G 15: 77,788,917 probably null Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Ncapg T G 5: 45,695,668 H825Q probably damaging Het
Olfml1 T C 7: 107,590,363 S212P probably benign Het
Olfr656 G A 7: 104,618,114 R145H probably benign Het
Pak2 T C 16: 32,052,211 N51S probably benign Het
Papln T C 12: 83,786,619 Y1132H probably damaging Het
Pax3 T A 1: 78,193,789 R134S probably damaging Het
Pdzrn4 A G 15: 92,770,937 E990G probably damaging Het
Peak1 A T 9: 56,207,476 W1394R probably damaging Het
Pkn2 T C 3: 142,829,010 N285D probably benign Het
Pramef12 A C 4: 144,395,857 L39R probably damaging Het
Prrc2a A G 17: 35,156,984 S897P possibly damaging Het
Rad51 A G 2: 119,123,831 T131A possibly damaging Het
Rc3h2 T A 2: 37,400,726 T255S possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rictor T A 15: 6,745,562 V125E probably damaging Het
Rps6ka5 C T 12: 100,558,487 D664N possibly damaging Het
Rreb1 T A 13: 37,947,621 W1584R probably damaging Het
Rxra T C 2: 27,741,183 I142T probably damaging Het
Sall2 T C 14: 52,312,886 T951A probably benign Het
Slc15a2 T G 16: 36,759,307 N359T probably damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc6a13 T C 6: 121,337,414 *603Q probably null Het
Sptb T C 12: 76,619,162 D894G possibly damaging Het
Srgn A G 10: 62,507,665 L17P probably damaging Het
Tmprss9 T C 10: 80,897,371 probably null Het
Trav9n-4 T C 14: 53,294,946 F86L probably benign Het
Trp63 A G 16: 25,876,734 Y482C unknown Het
Ttc9b G T 7: 27,653,969 A15S probably damaging Het
Urb1 A T 16: 90,791,190 I410N probably damaging Het
Vmn2r82 A T 10: 79,378,893 K237* probably null Het
Wwox G A 8: 114,489,005 probably null Het
Other mutations in Kcnmb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Kcnmb4 APN 10 116473346 missense probably benign 0.34
IGL02016:Kcnmb4 APN 10 116446462 splice site probably benign
R1499:Kcnmb4 UTSW 10 116473298 missense possibly damaging 0.52
R4355:Kcnmb4 UTSW 10 116473284 missense possibly damaging 0.57
R4361:Kcnmb4 UTSW 10 116473505 missense probably benign 0.13
R5058:Kcnmb4 UTSW 10 116463928 intron probably benign
R5074:Kcnmb4 UTSW 10 116473197 missense probably benign 0.00
R5463:Kcnmb4 UTSW 10 116473505 missense probably benign 0.13
R6562:Kcnmb4 UTSW 10 116473184 critical splice donor site probably null
R6883:Kcnmb4 UTSW 10 116473343 missense probably benign 0.00
R7103:Kcnmb4 UTSW 10 116473259 missense possibly damaging 0.94
R7486:Kcnmb4 UTSW 10 116418275 missense probably benign 0.13
R8284:Kcnmb4 UTSW 10 116418253 missense probably damaging 1.00
R8377:Kcnmb4 UTSW 10 116446385 missense probably benign 0.35
R8856:Kcnmb4 UTSW 10 116446394 missense possibly damaging 0.60
R8955:Kcnmb4 UTSW 10 116473476 nonsense probably null
R8991:Kcnmb4 UTSW 10 116446333 missense probably benign 0.00
R9219:Kcnmb4 UTSW 10 116473467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGTGCCTGTTTCTGCTG -3'
(R):5'- GTGATTATTCCCTACGCCGGAG -3'

Sequencing Primer
(F):5'- TTTCTGCTGCCGACGAG -3'
(R):5'- AGAGCACTTGTCGTCTGCAG -3'
Posted On 2020-09-02