Incidental Mutation 'R8324:Egfr'
ID 644000
Institutional Source Beutler Lab
Gene Symbol Egfr
Ensembl Gene ENSMUSG00000020122
Gene Name epidermal growth factor receptor
Synonyms 9030024J15Rik, avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, Errb1, Erbb
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.928) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 16702203-16868158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 16858885 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 955 (I955L)
Ref Sequence ENSEMBL: ENSMUSP00000020329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020329]
AlphaFold Q01279
Predicted Effect probably damaging
Transcript: ENSMUST00000020329
AA Change: I955L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: I955L

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 1.4e-32 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 1.8e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.05e1 SMART
low complexity region 677 694 N/A INTRINSIC
TyrKc 714 970 2.88e-129 SMART
low complexity region 1004 1017 N/A INTRINSIC
low complexity region 1027 1048 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Egfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Egfr APN 11 16,813,020 (GRCm39) missense probably damaging 1.00
IGL01529:Egfr APN 11 16,813,014 (GRCm39) missense probably benign
IGL01556:Egfr APN 11 16,855,382 (GRCm39) missense probably damaging 1.00
IGL02627:Egfr APN 11 16,819,346 (GRCm39) missense probably damaging 1.00
IGL02862:Egfr APN 11 16,833,562 (GRCm39) missense probably benign 0.25
IGL02945:Egfr APN 11 16,702,514 (GRCm39) missense probably damaging 1.00
IGL02994:Egfr APN 11 16,861,811 (GRCm39) missense probably damaging 1.00
IGL03395:Egfr APN 11 16,860,261 (GRCm39) splice site probably benign
set UTSW 11 16,821,881 (GRCm39) splice site probably benign
Velvet UTSW 11 16,854,399 (GRCm39) missense probably damaging 1.00
PIT1430001:Egfr UTSW 11 16,860,214 (GRCm39) missense probably benign 0.00
R0196:Egfr UTSW 11 16,861,746 (GRCm39) missense probably benign 0.02
R0513:Egfr UTSW 11 16,822,855 (GRCm39) missense probably damaging 1.00
R0567:Egfr UTSW 11 16,822,873 (GRCm39) missense probably benign 0.01
R0629:Egfr UTSW 11 16,819,333 (GRCm39) missense probably damaging 1.00
R0961:Egfr UTSW 11 16,812,964 (GRCm39) missense probably damaging 1.00
R1163:Egfr UTSW 11 16,833,546 (GRCm39) missense probably benign 0.02
R1454:Egfr UTSW 11 16,839,920 (GRCm39) missense probably benign
R1456:Egfr UTSW 11 16,813,065 (GRCm39) missense probably benign 0.00
R1503:Egfr UTSW 11 16,819,301 (GRCm39) missense possibly damaging 0.86
R1577:Egfr UTSW 11 16,819,241 (GRCm39) missense probably benign 0.04
R1595:Egfr UTSW 11 16,856,847 (GRCm39) missense probably damaging 0.99
R1699:Egfr UTSW 11 16,809,019 (GRCm39) missense probably benign 0.14
R2172:Egfr UTSW 11 16,861,562 (GRCm39) missense probably benign 0.00
R3690:Egfr UTSW 11 16,821,881 (GRCm39) splice site probably benign
R3922:Egfr UTSW 11 16,831,495 (GRCm39) missense probably damaging 1.00
R4444:Egfr UTSW 11 16,821,027 (GRCm39) missense probably benign 0.00
R4685:Egfr UTSW 11 16,808,980 (GRCm39) missense probably damaging 1.00
R4737:Egfr UTSW 11 16,819,231 (GRCm39) missense probably damaging 0.99
R4814:Egfr UTSW 11 16,819,354 (GRCm39) missense probably damaging 1.00
R4841:Egfr UTSW 11 16,861,607 (GRCm39) missense probably benign 0.05
R4842:Egfr UTSW 11 16,861,607 (GRCm39) missense probably benign 0.05
R4903:Egfr UTSW 11 16,858,949 (GRCm39) missense probably damaging 1.00
R4964:Egfr UTSW 11 16,858,949 (GRCm39) missense probably damaging 1.00
R4985:Egfr UTSW 11 16,809,029 (GRCm39) nonsense probably null
R4998:Egfr UTSW 11 16,831,493 (GRCm39) missense possibly damaging 0.58
R5001:Egfr UTSW 11 16,854,434 (GRCm39) missense probably damaging 0.98
R5304:Egfr UTSW 11 16,834,260 (GRCm39) missense probably benign
R5309:Egfr UTSW 11 16,861,703 (GRCm39) missense probably benign 0.00
R5653:Egfr UTSW 11 16,861,617 (GRCm39) missense probably benign 0.04
R5905:Egfr UTSW 11 16,861,494 (GRCm39) missense probably damaging 1.00
R6051:Egfr UTSW 11 16,833,607 (GRCm39) missense possibly damaging 0.87
R6052:Egfr UTSW 11 16,861,554 (GRCm39) missense probably benign 0.16
R6114:Egfr UTSW 11 16,854,374 (GRCm39) missense possibly damaging 0.46
R6261:Egfr UTSW 11 16,839,964 (GRCm39) missense probably benign 0.11
R6434:Egfr UTSW 11 16,819,294 (GRCm39) missense probably benign 0.25
R6475:Egfr UTSW 11 16,841,259 (GRCm39) missense probably benign
R6799:Egfr UTSW 11 16,846,952 (GRCm39) missense probably damaging 1.00
R7143:Egfr UTSW 11 16,821,627 (GRCm39) missense probably benign 0.20
R7195:Egfr UTSW 11 16,818,162 (GRCm39) missense probably damaging 1.00
R7459:Egfr UTSW 11 16,846,967 (GRCm39) missense probably damaging 1.00
R7612:Egfr UTSW 11 16,809,025 (GRCm39) missense possibly damaging 0.74
R7757:Egfr UTSW 11 16,839,966 (GRCm39) missense possibly damaging 0.64
R7763:Egfr UTSW 11 16,841,266 (GRCm39) missense probably damaging 1.00
R8315:Egfr UTSW 11 16,825,027 (GRCm39) missense probably benign 0.08
R8320:Egfr UTSW 11 16,841,251 (GRCm39) missense probably damaging 1.00
R8324:Egfr UTSW 11 16,808,971 (GRCm39) missense probably damaging 0.99
R8347:Egfr UTSW 11 16,828,174 (GRCm39) missense probably damaging 1.00
R8440:Egfr UTSW 11 16,859,831 (GRCm39) missense probably damaging 1.00
R8511:Egfr UTSW 11 16,846,949 (GRCm39) missense probably damaging 1.00
R8708:Egfr UTSW 11 16,817,300 (GRCm39) critical splice donor site probably benign
R8804:Egfr UTSW 11 16,819,339 (GRCm39) missense probably benign 0.09
R8853:Egfr UTSW 11 16,858,885 (GRCm39) missense possibly damaging 0.93
R8906:Egfr UTSW 11 16,861,635 (GRCm39) missense probably damaging 1.00
R9177:Egfr UTSW 11 16,855,410 (GRCm39) missense probably damaging 1.00
R9268:Egfr UTSW 11 16,855,410 (GRCm39) missense probably damaging 1.00
R9335:Egfr UTSW 11 16,820,991 (GRCm39) missense probably damaging 1.00
R9417:Egfr UTSW 11 16,825,067 (GRCm39) nonsense probably null
R9454:Egfr UTSW 11 16,837,155 (GRCm39) missense probably damaging 1.00
Z1177:Egfr UTSW 11 16,819,319 (GRCm39) missense probably damaging 1.00
Z1177:Egfr UTSW 11 16,812,954 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAACTGTTCTATAGGGCTGGG -3'
(R):5'- AGACTGTGTTGGCTCAGCAC -3'

Sequencing Primer
(F):5'- TTCTATAGGGCTGGGAATGAATC -3'
(R):5'- CACAGTGGCATCTGGACCTATTG -3'
Posted On 2020-09-02