Incidental Mutation 'R8324:Myo1d'
ID644003
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Namemyosin ID
Synonyms9930104H07Rik, D11Ertd9e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8324 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location80482126-80780025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80557521 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 926 (D926V)
Ref Sequence ENSEMBL: ENSMUSP00000037819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065]
Predicted Effect probably damaging
Transcript: ENSMUST00000041065
AA Change: D926V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: D926V

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Meta Mutation Damage Score 0.9431 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,290,395 S753P probably damaging Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Antxr2 T C 5: 97,938,509 N413S probably damaging Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
Caprin1 G A 2: 103,783,181 R79* probably null Het
Cdan1 A G 2: 120,727,325 V507A probably benign Het
Cdkl3 T A 11: 52,022,879 probably null Het
Chst5 A T 8: 111,890,508 L160Q probably benign Het
Col11a1 C G 3: 114,164,410 P1111R probably damaging Het
Col6a6 T A 9: 105,755,654 E1470D probably benign Het
Cpped1 T A 16: 11,805,476 T274S probably benign Het
Ctnnbl1 G A 2: 157,779,815 E75K probably damaging Het
Cyp4f40 T C 17: 32,659,528 S15P probably benign Het
Ddx46 T C 13: 55,663,914 S643P probably damaging Het
Defb34 A G 8: 19,123,798 Q16R probably null Het
Dhrs2 T A 14: 55,238,764 V147E probably damaging Het
Dnah5 G T 15: 28,346,865 R2498L probably damaging Het
Dpp10 T A 1: 123,854,172 I93F probably benign Het
Eef1e1 T A 13: 38,655,069 D104V probably damaging Het
Egfr A G 11: 16,858,971 Y55C probably damaging Het
Egfr A C 11: 16,908,885 I955L probably damaging Het
Ehbp1l1 C A 19: 5,719,998 V426F possibly damaging Het
Fam234a C T 17: 26,218,698 V108I probably benign Het
Fzd8 T A 18: 9,214,688 M590K probably damaging Het
Gm13287 T C 4: 88,803,638 S129P probably damaging Het
Heatr5b A G 17: 78,755,364 S1919P possibly damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ikbkap C T 4: 56,772,491 E877K probably damaging Het
Itpr2 T C 6: 146,328,398 E1233G probably damaging Het
Kcnmb4 A G 10: 116,418,314 L186P probably damaging Het
Krt72 T A 15: 101,782,145 Y224F probably damaging Het
Loxhd1 T C 18: 77,339,579 probably null Het
Lrguk A G 6: 34,102,571 T914A probably benign Het
Lrrtm4 A G 6: 80,021,991 T129A probably damaging Het
Mmp13 A T 9: 7,276,636 I244F possibly damaging Het
Mob1a T A 6: 83,329,974 L41Q probably damaging Het
Mtcl1 T C 17: 66,436,217 R426G probably damaging Het
Mybbp1a T C 11: 72,445,288 probably null Het
Myh9 A G 15: 77,788,917 probably null Het
Ncapg T G 5: 45,695,668 H825Q probably damaging Het
Olfml1 T C 7: 107,590,363 S212P probably benign Het
Olfr656 G A 7: 104,618,114 R145H probably benign Het
Pak2 T C 16: 32,052,211 N51S probably benign Het
Papln T C 12: 83,786,619 Y1132H probably damaging Het
Pax3 T A 1: 78,193,789 R134S probably damaging Het
Pdzrn4 A G 15: 92,770,937 E990G probably damaging Het
Peak1 A T 9: 56,207,476 W1394R probably damaging Het
Pkn2 T C 3: 142,829,010 N285D probably benign Het
Pramef12 A C 4: 144,395,857 L39R probably damaging Het
Prrc2a A G 17: 35,156,984 S897P possibly damaging Het
Rad51 A G 2: 119,123,831 T131A possibly damaging Het
Rc3h2 T A 2: 37,400,726 T255S possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rictor T A 15: 6,745,562 V125E probably damaging Het
Rps6ka5 C T 12: 100,558,487 D664N possibly damaging Het
Rreb1 T A 13: 37,947,621 W1584R probably damaging Het
Rxra T C 2: 27,741,183 I142T probably damaging Het
Sall2 T C 14: 52,312,886 T951A probably benign Het
Slc15a2 T G 16: 36,759,307 N359T probably damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc6a13 T C 6: 121,337,414 *603Q probably null Het
Sptb T C 12: 76,619,162 D894G possibly damaging Het
Srgn A G 10: 62,507,665 L17P probably damaging Het
Tmprss9 T C 10: 80,897,371 probably null Het
Trav9n-4 T C 14: 53,294,946 F86L probably benign Het
Trp63 A G 16: 25,876,734 Y482C unknown Het
Ttc9b G T 7: 27,653,969 A15S probably damaging Het
Urb1 A T 16: 90,791,190 I410N probably damaging Het
Vmn2r82 A T 10: 79,378,893 K237* probably null Het
Wwox G A 8: 114,489,005 probably null Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80601740 missense probably benign
IGL01087:Myo1d APN 11 80682435 missense probably damaging 1.00
IGL01326:Myo1d APN 11 80684321 splice site probably benign
IGL01431:Myo1d APN 11 80674839 missense probably damaging 1.00
IGL01595:Myo1d APN 11 80676110 missense probably benign 0.00
IGL01811:Myo1d APN 11 80692997 missense probably damaging 0.96
IGL02301:Myo1d APN 11 80676853 missense probably benign 0.23
IGL02388:Myo1d APN 11 80637997 nonsense probably null
IGL02485:Myo1d APN 11 80666581 missense probably damaging 1.00
IGL03017:Myo1d APN 11 80601626 missense probably benign 0.26
horton UTSW 11 80674708 missense probably damaging 1.00
multifaceted UTSW 11 80693072 missense probably damaging 1.00
whisper UTSW 11 80484332 missense probably damaging 0.99
whisper2 UTSW 11 80666578 missense probably damaging 1.00
whisper3 UTSW 11 80557521 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0081:Myo1d UTSW 11 80557523 missense probably benign 0.00
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0244:Myo1d UTSW 11 80674708 missense probably damaging 1.00
R0711:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0746:Myo1d UTSW 11 80586879 missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80684395 missense probably damaging 1.00
R1514:Myo1d UTSW 11 80685908 missense probably damaging 0.97
R1676:Myo1d UTSW 11 80684421 missense probably damaging 1.00
R1862:Myo1d UTSW 11 80663048 missense probably damaging 1.00
R2497:Myo1d UTSW 11 80674821 missense probably damaging 1.00
R2512:Myo1d UTSW 11 80779717 missense probably benign 0.00
R3425:Myo1d UTSW 11 80601638 missense probably benign
R3429:Myo1d UTSW 11 80682410 missense probably damaging 1.00
R3917:Myo1d UTSW 11 80666578 missense probably damaging 1.00
R3928:Myo1d UTSW 11 80484261 missense probably benign 0.09
R4706:Myo1d UTSW 11 80666641 missense probably damaging 0.96
R4723:Myo1d UTSW 11 80779841 utr 5 prime probably benign
R4924:Myo1d UTSW 11 80674678 missense probably damaging 1.00
R5042:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R5320:Myo1d UTSW 11 80684323 critical splice donor site probably null
R5481:Myo1d UTSW 11 80663095 missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80779791 start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80692944 missense probably benign 0.23
R6282:Myo1d UTSW 11 80557512 missense probably damaging 0.99
R6468:Myo1d UTSW 11 80557474 missense probably benign 0.00
R6668:Myo1d UTSW 11 80583875 intron probably benign
R6954:Myo1d UTSW 11 80674957 missense probably benign 0.21
R7077:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7078:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7080:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7172:Myo1d UTSW 11 80592795 missense probably benign 0.16
R7276:Myo1d UTSW 11 80693072 missense probably damaging 1.00
R7467:Myo1d UTSW 11 80586917 missense probably damaging 1.00
R7650:Myo1d UTSW 11 80601684 missense probably benign
R7678:Myo1d UTSW 11 80676893 missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80684377 missense probably damaging 1.00
R8329:Myo1d UTSW 11 80638074 missense probably benign 0.21
R8474:Myo1d UTSW 11 80670919 missense possibly damaging 0.93
R8799:Myo1d UTSW 11 80684379 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80674932 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80676932 missense probably benign 0.30
R8823:Myo1d UTSW 11 80601745 missense possibly damaging 0.91
Z1088:Myo1d UTSW 11 80674898 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCCGGATGCTAATTTCACC -3'
(R):5'- CCTTACTCCATGAAACTTGTTAAAGG -3'

Sequencing Primer
(F):5'- GCCGGATGCTAATTTCACCTTCTATG -3'
(R):5'- GGTTAAAATCGTCACCATCGTTGC -3'
Posted On2020-09-02