Incidental Mutation 'R8324:Papln'
ID 644005
Institutional Source Beutler Lab
Gene Symbol Papln
Ensembl Gene ENSMUSG00000021223
Gene Name papilin, proteoglycan-like sulfated glycoprotein
Synonyms E030033C16Rik
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 83810408-83839156 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83833393 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1132 (Y1132H)
Ref Sequence ENSEMBL: ENSMUSP00000113806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021646] [ENSMUST00000121733]
AlphaFold Q9EPX2
Predicted Effect probably damaging
Transcript: ENSMUST00000021646
AA Change: Y1110H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021646
Gene: ENSMUSG00000021223
AA Change: Y1110H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 3.3e-39 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 366 426 2.76e-7 SMART
TSP1 427 482 1.42e-9 SMART
TSP1 488 540 2.47e-9 SMART
low complexity region 604 621 N/A INTRINSIC
KU 748 801 1.83e-22 SMART
low complexity region 822 831 N/A INTRINSIC
IGc2 917 980 2.88e-4 SMART
IGc2 1056 1119 2.66e-17 SMART
IGc2 1145 1209 2.13e-7 SMART
Pfam:PLAC 1234 1268 2.3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121733
AA Change: Y1132H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113806
Gene: ENSMUSG00000021223
AA Change: Y1132H

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 2.8e-38 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 388 448 1.82e-7 SMART
TSP1 449 504 1.42e-9 SMART
TSP1 510 562 2.47e-9 SMART
low complexity region 626 643 N/A INTRINSIC
KU 770 823 1.83e-22 SMART
Pfam:Papilin_u7 831 922 1.9e-40 PFAM
IGc2 939 1002 2.88e-4 SMART
IGc2 1078 1141 2.66e-17 SMART
IGc2 1167 1231 2.13e-7 SMART
Pfam:PLAC 1257 1289 1.1e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Papln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Papln APN 12 83,817,210 (GRCm39) missense possibly damaging 0.81
IGL01788:Papln APN 12 83,822,236 (GRCm39) missense probably benign 0.32
IGL01889:Papln APN 12 83,833,609 (GRCm39) missense probably benign 0.25
IGL02499:Papln APN 12 83,827,445 (GRCm39) missense probably benign 0.00
IGL02567:Papln APN 12 83,825,611 (GRCm39) missense probably benign 0.00
IGL03150:Papln APN 12 83,829,758 (GRCm39) missense probably damaging 1.00
IGL03331:Papln APN 12 83,830,435 (GRCm39) missense probably benign
F5770:Papln UTSW 12 83,825,608 (GRCm39) missense possibly damaging 0.72
R0201:Papln UTSW 12 83,829,801 (GRCm39) splice site probably benign
R0389:Papln UTSW 12 83,830,153 (GRCm39) nonsense probably null
R0763:Papln UTSW 12 83,838,639 (GRCm39) missense possibly damaging 0.54
R1508:Papln UTSW 12 83,829,690 (GRCm39) missense probably damaging 0.99
R1628:Papln UTSW 12 83,831,180 (GRCm39) splice site probably benign
R1920:Papln UTSW 12 83,836,028 (GRCm39) nonsense probably null
R1974:Papln UTSW 12 83,828,811 (GRCm39) missense probably damaging 0.98
R2004:Papln UTSW 12 83,819,992 (GRCm39) missense probably damaging 1.00
R2105:Papln UTSW 12 83,827,010 (GRCm39) missense probably benign 0.04
R2876:Papln UTSW 12 83,825,701 (GRCm39) missense probably damaging 0.96
R4199:Papln UTSW 12 83,830,166 (GRCm39) missense probably null 0.01
R4702:Papln UTSW 12 83,828,757 (GRCm39) missense probably benign 0.01
R4705:Papln UTSW 12 83,823,982 (GRCm39) splice site probably null
R4835:Papln UTSW 12 83,821,194 (GRCm39) missense probably damaging 0.99
R4874:Papln UTSW 12 83,823,917 (GRCm39) missense probably benign 0.01
R4938:Papln UTSW 12 83,829,677 (GRCm39) missense probably benign 0.35
R5000:Papln UTSW 12 83,821,663 (GRCm39) missense probably damaging 1.00
R5149:Papln UTSW 12 83,818,656 (GRCm39) splice site probably null
R5324:Papln UTSW 12 83,821,345 (GRCm39) missense probably damaging 1.00
R5784:Papln UTSW 12 83,828,754 (GRCm39) missense probably benign
R5881:Papln UTSW 12 83,818,652 (GRCm39) missense probably null 0.91
R5977:Papln UTSW 12 83,831,143 (GRCm39) nonsense probably null
R6035:Papln UTSW 12 83,821,454 (GRCm39) missense probably damaging 1.00
R6035:Papln UTSW 12 83,821,454 (GRCm39) missense probably damaging 1.00
R6291:Papln UTSW 12 83,829,789 (GRCm39) missense probably benign 0.01
R6461:Papln UTSW 12 83,828,587 (GRCm39) splice site probably null
R6536:Papln UTSW 12 83,828,661 (GRCm39) missense probably damaging 1.00
R6861:Papln UTSW 12 83,821,723 (GRCm39) missense probably damaging 1.00
R6898:Papln UTSW 12 83,824,234 (GRCm39) missense probably benign 0.03
R6953:Papln UTSW 12 83,828,659 (GRCm39) nonsense probably null
R7155:Papln UTSW 12 83,823,295 (GRCm39) missense probably damaging 1.00
R7450:Papln UTSW 12 83,826,945 (GRCm39) missense probably benign 0.13
R7510:Papln UTSW 12 83,818,947 (GRCm39) missense probably damaging 0.99
R7850:Papln UTSW 12 83,827,436 (GRCm39) missense probably damaging 1.00
R7977:Papln UTSW 12 83,822,156 (GRCm39) missense probably damaging 1.00
R7987:Papln UTSW 12 83,822,156 (GRCm39) missense probably damaging 1.00
R8321:Papln UTSW 12 83,821,715 (GRCm39) nonsense probably null
R8466:Papln UTSW 12 83,825,255 (GRCm39) critical splice acceptor site probably null
R8743:Papln UTSW 12 83,829,764 (GRCm39) missense probably damaging 1.00
R8790:Papln UTSW 12 83,823,918 (GRCm39) missense probably benign 0.01
R9086:Papln UTSW 12 83,821,633 (GRCm39) missense probably damaging 1.00
R9291:Papln UTSW 12 83,825,284 (GRCm39) missense probably benign 0.01
R9350:Papln UTSW 12 83,833,638 (GRCm39) missense probably damaging 1.00
R9438:Papln UTSW 12 83,818,606 (GRCm39) missense probably benign
R9484:Papln UTSW 12 83,838,618 (GRCm39) missense probably benign 0.05
V7580:Papln UTSW 12 83,825,608 (GRCm39) missense possibly damaging 0.72
V7581:Papln UTSW 12 83,825,608 (GRCm39) missense possibly damaging 0.72
V7582:Papln UTSW 12 83,825,608 (GRCm39) missense possibly damaging 0.72
Z1088:Papln UTSW 12 83,823,150 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCCAGGTATCATCAAGTGACTTACTG -3'
(R):5'- AGGCCTGTGATTGTCAGCTC -3'

Sequencing Primer
(F):5'- CATCAAGTGACTTACTGAAGTGCAG -3'
(R):5'- CTCCCCTAGGCATGAGAAGATATTG -3'
Posted On 2020-09-02