Incidental Mutation 'R8324:Rps6ka5'
ID 644006
Institutional Source Beutler Lab
Gene Symbol Rps6ka5
Ensembl Gene ENSMUSG00000021180
Gene Name ribosomal protein S6 kinase, polypeptide 5
Synonyms 3110005L17Rik, MSK1, 6330404E13Rik
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 100514692-100691693 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 100524746 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 664 (D664N)
Ref Sequence ENSEMBL: ENSMUSP00000042987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043599] [ENSMUST00000222731]
AlphaFold Q8C050
Predicted Effect possibly damaging
Transcript: ENSMUST00000043599
AA Change: D664N

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042987
Gene: ENSMUSG00000021180
AA Change: D664N

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
S_TKc 48 317 1.08e-101 SMART
S_TK_X 318 378 2.45e-13 SMART
S_TKc 425 751 1.1e-75 SMART
low complexity region 812 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221356
Predicted Effect possibly damaging
Transcript: ENSMUST00000222731
AA Change: D599N

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a mutant allele exhibit altered response to cocaine including decreased hyperlocomotor activity and sensitization at a lower dose. Mice homozygous for a kinase dead allele exhibit altered experience-dependent synaptic plasticity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Rps6ka5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Rps6ka5 APN 12 100,540,157 (GRCm39) missense probably benign
IGL01450:Rps6ka5 APN 12 100,519,250 (GRCm39) splice site probably benign
IGL01586:Rps6ka5 APN 12 100,537,173 (GRCm39) missense probably damaging 0.99
IGL01743:Rps6ka5 APN 12 100,541,892 (GRCm39) critical splice donor site probably null
IGL02995:Rps6ka5 APN 12 100,540,258 (GRCm39) intron probably benign
IGL03051:Rps6ka5 APN 12 100,582,250 (GRCm39) splice site probably null
IGL03190:Rps6ka5 APN 12 100,524,907 (GRCm39) splice site probably benign
chard UTSW 12 100,582,342 (GRCm39) missense probably damaging 1.00
Ramp UTSW 12 100,541,964 (GRCm39) missense possibly damaging 0.85
zwiebel UTSW 12 100,644,797 (GRCm39) missense probably damaging 0.99
R0055:Rps6ka5 UTSW 12 100,644,839 (GRCm39) missense probably damaging 0.97
R0055:Rps6ka5 UTSW 12 100,644,839 (GRCm39) missense probably damaging 0.97
R0067:Rps6ka5 UTSW 12 100,582,342 (GRCm39) missense probably damaging 1.00
R0212:Rps6ka5 UTSW 12 100,519,428 (GRCm39) splice site probably null
R0761:Rps6ka5 UTSW 12 100,537,141 (GRCm39) missense probably damaging 1.00
R0893:Rps6ka5 UTSW 12 100,540,697 (GRCm39) missense possibly damaging 0.71
R1237:Rps6ka5 UTSW 12 100,541,964 (GRCm39) missense possibly damaging 0.85
R1254:Rps6ka5 UTSW 12 100,585,788 (GRCm39) missense probably damaging 1.00
R1447:Rps6ka5 UTSW 12 100,544,084 (GRCm39) missense probably benign 0.02
R1611:Rps6ka5 UTSW 12 100,537,111 (GRCm39) missense possibly damaging 0.77
R2086:Rps6ka5 UTSW 12 100,585,874 (GRCm39) missense possibly damaging 0.67
R2129:Rps6ka5 UTSW 12 100,644,797 (GRCm39) missense probably damaging 0.99
R2298:Rps6ka5 UTSW 12 100,517,713 (GRCm39) missense probably damaging 0.99
R2432:Rps6ka5 UTSW 12 100,520,664 (GRCm39) missense probably damaging 0.98
R4378:Rps6ka5 UTSW 12 100,564,196 (GRCm39) missense probably damaging 1.00
R4394:Rps6ka5 UTSW 12 100,547,578 (GRCm39) missense probably damaging 0.97
R4461:Rps6ka5 UTSW 12 100,537,123 (GRCm39) missense probably damaging 0.99
R4584:Rps6ka5 UTSW 12 100,547,577 (GRCm39) missense probably damaging 1.00
R4672:Rps6ka5 UTSW 12 100,620,546 (GRCm39) missense possibly damaging 0.93
R4706:Rps6ka5 UTSW 12 100,564,144 (GRCm39) splice site probably null
R4706:Rps6ka5 UTSW 12 100,547,578 (GRCm39) missense probably damaging 0.97
R4707:Rps6ka5 UTSW 12 100,564,144 (GRCm39) splice site probably null
R4966:Rps6ka5 UTSW 12 100,519,325 (GRCm39) missense probably benign 0.01
R5059:Rps6ka5 UTSW 12 100,520,634 (GRCm39) missense probably damaging 0.96
R5404:Rps6ka5 UTSW 12 100,582,352 (GRCm39) missense probably damaging 1.00
R5660:Rps6ka5 UTSW 12 100,585,839 (GRCm39) missense possibly damaging 0.95
R5678:Rps6ka5 UTSW 12 100,691,135 (GRCm39) missense unknown
R5992:Rps6ka5 UTSW 12 100,541,509 (GRCm39) missense possibly damaging 0.68
R6104:Rps6ka5 UTSW 12 100,519,407 (GRCm39) missense possibly damaging 0.84
R6163:Rps6ka5 UTSW 12 100,562,179 (GRCm39) critical splice acceptor site probably null
R6390:Rps6ka5 UTSW 12 100,537,251 (GRCm39) missense probably damaging 0.99
R6599:Rps6ka5 UTSW 12 100,564,168 (GRCm39) missense probably damaging 1.00
R6653:Rps6ka5 UTSW 12 100,517,795 (GRCm39) missense probably damaging 1.00
R6693:Rps6ka5 UTSW 12 100,540,088 (GRCm39) missense probably benign 0.11
R7009:Rps6ka5 UTSW 12 100,585,796 (GRCm39) missense probably damaging 1.00
R7157:Rps6ka5 UTSW 12 100,547,679 (GRCm39) missense probably damaging 1.00
R7196:Rps6ka5 UTSW 12 100,562,123 (GRCm39) missense possibly damaging 0.77
R7510:Rps6ka5 UTSW 12 100,582,327 (GRCm39) missense possibly damaging 0.56
R7565:Rps6ka5 UTSW 12 100,582,342 (GRCm39) missense probably damaging 1.00
R7800:Rps6ka5 UTSW 12 100,524,824 (GRCm39) missense probably damaging 0.97
R7843:Rps6ka5 UTSW 12 100,519,408 (GRCm39) missense possibly damaging 0.92
R8009:Rps6ka5 UTSW 12 100,544,048 (GRCm39) missense probably damaging 0.97
R8057:Rps6ka5 UTSW 12 100,540,055 (GRCm39) critical splice donor site probably null
R8292:Rps6ka5 UTSW 12 100,644,791 (GRCm39) missense possibly damaging 0.83
R8428:Rps6ka5 UTSW 12 100,541,500 (GRCm39) nonsense probably null
R8913:Rps6ka5 UTSW 12 100,520,595 (GRCm39) missense
R9711:Rps6ka5 UTSW 12 100,540,250 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGAAATATAATTAGTGGGACCAC -3'
(R):5'- AGAAATCAGCAGATCTCCTGTC -3'

Sequencing Primer
(F):5'- GGGACCACTGCTTGTTATACAG -3'
(R):5'- TGTCATCTCCATGGGAATCTAACCAG -3'
Posted On 2020-09-02