Mutagenetix > Incidental Mutation

Incidental Mutation 'R8324:Sall2'

644010

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8324 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52312886 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 951 (T951A)

Ref Sequence

ENSEMBL: ENSMUSP00000056401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably benign
Transcript: ENSMUST00000058326
AA Change: T951A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: T951A

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135523
AA Change: T949A

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,290,395	S753P	probably damaging	Het
Acan	A	G	7: 79,091,056	E390G	probably damaging	Het
Antxr2	T	C	5: 97,938,509	N413S	probably damaging	Het
Bace2	C	T	16: 97,356,908	A36V	possibly damaging	Het
Caprin1	G	A	2: 103,783,181	R79*	probably null	Het
Cdan1	A	G	2: 120,727,325	V507A	probably benign	Het
Cdkl3	T	A	11: 52,022,879		probably null	Het
Chst5	A	T	8: 111,890,508	L160Q	probably benign	Het
Col11a1	C	G	3: 114,164,410	P1111R	probably damaging	Het
Col6a6	T	A	9: 105,755,654	E1470D	probably benign	Het
Cpped1	T	A	16: 11,805,476	T274S	probably benign	Het
Ctnnbl1	G	A	2: 157,779,815	E75K	probably damaging	Het
Cyp4f40	T	C	17: 32,659,528	S15P	probably benign	Het
Ddx46	T	C	13: 55,663,914	S643P	probably damaging	Het
Defb34	A	G	8: 19,123,798	Q16R	probably null	Het
Dhrs2	T	A	14: 55,238,764	V147E	probably damaging	Het
Dnah5	G	T	15: 28,346,865	R2498L	probably damaging	Het
Dpp10	T	A	1: 123,854,172	I93F	probably benign	Het
Eef1e1	T	A	13: 38,655,069	D104V	probably damaging	Het
Egfr	A	G	11: 16,858,971	Y55C	probably damaging	Het
Egfr	A	C	11: 16,908,885	I955L	probably damaging	Het
Ehbp1l1	C	A	19: 5,719,998	V426F	possibly damaging	Het
Fam234a	C	T	17: 26,218,698	V108I	probably benign	Het
Fzd8	T	A	18: 9,214,688	M590K	probably damaging	Het
Gm13287	T	C	4: 88,803,638	S129P	probably damaging	Het
Heatr5b	A	G	17: 78,755,364	S1919P	possibly damaging	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Ikbkap	C	T	4: 56,772,491	E877K	probably damaging	Het
Itpr2	T	C	6: 146,328,398	E1233G	probably damaging	Het
Kcnmb4	A	G	10: 116,418,314	L186P	probably damaging	Het
Krt72	T	A	15: 101,782,145	Y224F	probably damaging	Het
Loxhd1	T	C	18: 77,339,579		probably null	Het
Lrguk	A	G	6: 34,102,571	T914A	probably benign	Het
Lrrtm4	A	G	6: 80,021,991	T129A	probably damaging	Het
Mmp13	A	T	9: 7,276,636	I244F	possibly damaging	Het
Mob1a	T	A	6: 83,329,974	L41Q	probably damaging	Het
Mtcl1	T	C	17: 66,436,217	R426G	probably damaging	Het
Mybbp1a	T	C	11: 72,445,288		probably null	Het
Myh9	A	G	15: 77,788,917		probably null	Het
Myo1d	T	A	11: 80,557,521	D926V	probably damaging	Het
Ncapg	T	G	5: 45,695,668	H825Q	probably damaging	Het
Olfml1	T	C	7: 107,590,363	S212P	probably benign	Het
Olfr656	G	A	7: 104,618,114	R145H	probably benign	Het
Pak2	T	C	16: 32,052,211	N51S	probably benign	Het
Papln	T	C	12: 83,786,619	Y1132H	probably damaging	Het
Pax3	T	A	1: 78,193,789	R134S	probably damaging	Het
Pdzrn4	A	G	15: 92,770,937	E990G	probably damaging	Het
Peak1	A	T	9: 56,207,476	W1394R	probably damaging	Het
Pkn2	T	C	3: 142,829,010	N285D	probably benign	Het
Pramef12	A	C	4: 144,395,857	L39R	probably damaging	Het
Prrc2a	A	G	17: 35,156,984	S897P	possibly damaging	Het
Rad51	A	G	2: 119,123,831	T131A	possibly damaging	Het
Rc3h2	T	A	2: 37,400,726	T255S	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rictor	T	A	15: 6,745,562	V125E	probably damaging	Het
Rps6ka5	C	T	12: 100,558,487	D664N	possibly damaging	Het
Rreb1	T	A	13: 37,947,621	W1584R	probably damaging	Het
Rxra	T	C	2: 27,741,183	I142T	probably damaging	Het
Slc15a2	T	G	16: 36,759,307	N359T	probably damaging	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Slc6a13	T	C	6: 121,337,414	*603Q	probably null	Het
Sptb	T	C	12: 76,619,162	D894G	possibly damaging	Het
Srgn	A	G	10: 62,507,665	L17P	probably damaging	Het
Tmprss9	T	C	10: 80,897,371		probably null	Het
Trav9n-4	T	C	14: 53,294,946	F86L	probably benign	Het
Trp63	A	G	16: 25,876,734	Y482C	unknown	Het
Ttc9b	G	T	7: 27,653,969	A15S	probably damaging	Het
Urb1	A	T	16: 90,791,190	I410N	probably damaging	Het
Vmn2r82	A	T	10: 79,378,893	K237*	probably null	Het
Wwox	G	A	8: 114,489,005		probably null	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- ATGAAGCTCTCAGGTTTCTGC -3'
(R):5'- AACTTACCGGAAGCCATGAAG -3'

Sequencing Primer
(F):5'- TGCTCTCTGAGTCATAGAGGACCAG -3'
(R):5'- TTACCGGAAGCCATGAAGAAGGATC -3'

Posted On

2020-09-02