Incidental Mutation 'R8324:Sall2'
ID 644010
Institutional Source Beutler Lab
Gene Symbol Sall2
Ensembl Gene ENSMUSG00000049532
Gene Name spalt like transcription factor 2
Synonyms Msal-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 52311172-52328762 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52312886 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 951 (T951A)
Ref Sequence ENSEMBL: ENSMUSP00000056401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]
AlphaFold Q9QX96
Predicted Effect probably benign
Transcript: ENSMUST00000058326
AA Change: T951A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: T951A

DomainStartEndE-ValueType
low complexity region 71 81 N/A INTRINSIC
low complexity region 97 110 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
ZnF_C2H2 372 394 2.57e-3 SMART
ZnF_C2H2 400 422 1.28e-3 SMART
low complexity region 476 501 N/A INTRINSIC
low complexity region 602 627 N/A INTRINSIC
ZnF_C2H2 629 651 1.2e1 SMART
ZnF_C2H2 657 679 1.69e-3 SMART
ZnF_C2H2 689 711 6.88e-4 SMART
low complexity region 719 730 N/A INTRINSIC
low complexity region 747 779 N/A INTRINSIC
low complexity region 799 819 N/A INTRINSIC
low complexity region 829 848 N/A INTRINSIC
ZnF_C2H2 908 930 2.09e-3 SMART
ZnF_C2H2 937 960 1.01e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135523
AA Change: T949A

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,290,395 S753P probably damaging Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Antxr2 T C 5: 97,938,509 N413S probably damaging Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
Caprin1 G A 2: 103,783,181 R79* probably null Het
Cdan1 A G 2: 120,727,325 V507A probably benign Het
Cdkl3 T A 11: 52,022,879 probably null Het
Chst5 A T 8: 111,890,508 L160Q probably benign Het
Col11a1 C G 3: 114,164,410 P1111R probably damaging Het
Col6a6 T A 9: 105,755,654 E1470D probably benign Het
Cpped1 T A 16: 11,805,476 T274S probably benign Het
Ctnnbl1 G A 2: 157,779,815 E75K probably damaging Het
Cyp4f40 T C 17: 32,659,528 S15P probably benign Het
Ddx46 T C 13: 55,663,914 S643P probably damaging Het
Defb34 A G 8: 19,123,798 Q16R probably null Het
Dhrs2 T A 14: 55,238,764 V147E probably damaging Het
Dnah5 G T 15: 28,346,865 R2498L probably damaging Het
Dpp10 T A 1: 123,854,172 I93F probably benign Het
Eef1e1 T A 13: 38,655,069 D104V probably damaging Het
Egfr A G 11: 16,858,971 Y55C probably damaging Het
Egfr A C 11: 16,908,885 I955L probably damaging Het
Ehbp1l1 C A 19: 5,719,998 V426F possibly damaging Het
Fam234a C T 17: 26,218,698 V108I probably benign Het
Fzd8 T A 18: 9,214,688 M590K probably damaging Het
Gm13287 T C 4: 88,803,638 S129P probably damaging Het
Heatr5b A G 17: 78,755,364 S1919P possibly damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ikbkap C T 4: 56,772,491 E877K probably damaging Het
Itpr2 T C 6: 146,328,398 E1233G probably damaging Het
Kcnmb4 A G 10: 116,418,314 L186P probably damaging Het
Krt72 T A 15: 101,782,145 Y224F probably damaging Het
Loxhd1 T C 18: 77,339,579 probably null Het
Lrguk A G 6: 34,102,571 T914A probably benign Het
Lrrtm4 A G 6: 80,021,991 T129A probably damaging Het
Mmp13 A T 9: 7,276,636 I244F possibly damaging Het
Mob1a T A 6: 83,329,974 L41Q probably damaging Het
Mtcl1 T C 17: 66,436,217 R426G probably damaging Het
Mybbp1a T C 11: 72,445,288 probably null Het
Myh9 A G 15: 77,788,917 probably null Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Ncapg T G 5: 45,695,668 H825Q probably damaging Het
Olfml1 T C 7: 107,590,363 S212P probably benign Het
Olfr656 G A 7: 104,618,114 R145H probably benign Het
Pak2 T C 16: 32,052,211 N51S probably benign Het
Papln T C 12: 83,786,619 Y1132H probably damaging Het
Pax3 T A 1: 78,193,789 R134S probably damaging Het
Pdzrn4 A G 15: 92,770,937 E990G probably damaging Het
Peak1 A T 9: 56,207,476 W1394R probably damaging Het
Pkn2 T C 3: 142,829,010 N285D probably benign Het
Pramef12 A C 4: 144,395,857 L39R probably damaging Het
Prrc2a A G 17: 35,156,984 S897P possibly damaging Het
Rad51 A G 2: 119,123,831 T131A possibly damaging Het
Rc3h2 T A 2: 37,400,726 T255S possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rictor T A 15: 6,745,562 V125E probably damaging Het
Rps6ka5 C T 12: 100,558,487 D664N possibly damaging Het
Rreb1 T A 13: 37,947,621 W1584R probably damaging Het
Rxra T C 2: 27,741,183 I142T probably damaging Het
Slc15a2 T G 16: 36,759,307 N359T probably damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc6a13 T C 6: 121,337,414 *603Q probably null Het
Sptb T C 12: 76,619,162 D894G possibly damaging Het
Srgn A G 10: 62,507,665 L17P probably damaging Het
Tmprss9 T C 10: 80,897,371 probably null Het
Trav9n-4 T C 14: 53,294,946 F86L probably benign Het
Trp63 A G 16: 25,876,734 Y482C unknown Het
Ttc9b G T 7: 27,653,969 A15S probably damaging Het
Urb1 A T 16: 90,791,190 I410N probably damaging Het
Vmn2r82 A T 10: 79,378,893 K237* probably null Het
Wwox G A 8: 114,489,005 probably null Het
Other mutations in Sall2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01587:Sall2 APN 14 52314571 missense probably damaging 1.00
IGL02152:Sall2 APN 14 52315514 missense probably damaging 1.00
IGL02318:Sall2 APN 14 52315565 missense probably damaging 1.00
IGL02933:Sall2 APN 14 52313027 missense probably benign 0.00
IGL03165:Sall2 APN 14 52314168 missense probably damaging 1.00
R1079:Sall2 UTSW 14 52313203 missense probably benign 0.13
R1295:Sall2 UTSW 14 52313725 missense probably damaging 1.00
R1674:Sall2 UTSW 14 52313836 missense probably damaging 1.00
R1840:Sall2 UTSW 14 52313725 missense probably damaging 1.00
R1989:Sall2 UTSW 14 52314439 missense probably damaging 1.00
R2339:Sall2 UTSW 14 52313356 missense probably damaging 1.00
R3407:Sall2 UTSW 14 52328104 missense probably benign 0.03
R3870:Sall2 UTSW 14 52313994 missense probably damaging 1.00
R3895:Sall2 UTSW 14 52314047 missense probably damaging 0.99
R4059:Sall2 UTSW 14 52314571 missense probably damaging 1.00
R4272:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4273:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4275:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4289:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4503:Sall2 UTSW 14 52313459 missense probably benign
R4592:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4611:Sall2 UTSW 14 52313753 missense probably damaging 1.00
R4615:Sall2 UTSW 14 52312750 missense probably benign 0.20
R4640:Sall2 UTSW 14 52315159 missense probably damaging 0.99
R4693:Sall2 UTSW 14 52314478 missense probably damaging 1.00
R4921:Sall2 UTSW 14 52315393 missense possibly damaging 0.93
R5007:Sall2 UTSW 14 52314493 missense probably damaging 1.00
R5015:Sall2 UTSW 14 52315655 missense possibly damaging 0.92
R5079:Sall2 UTSW 14 52314754 missense probably damaging 1.00
R5419:Sall2 UTSW 14 52313129 missense probably damaging 1.00
R5849:Sall2 UTSW 14 52314247 missense probably benign 0.13
R6229:Sall2 UTSW 14 52313191 missense probably benign
R6397:Sall2 UTSW 14 52315153 missense probably damaging 1.00
R6422:Sall2 UTSW 14 52312724 makesense probably null
R6456:Sall2 UTSW 14 52313593 missense probably damaging 1.00
R6456:Sall2 UTSW 14 52313594 nonsense probably null
R6786:Sall2 UTSW 14 52314621 missense probably damaging 1.00
R7293:Sall2 UTSW 14 52314411 nonsense probably null
R7496:Sall2 UTSW 14 52315561 missense possibly damaging 0.63
R7792:Sall2 UTSW 14 52316064 missense probably damaging 1.00
R9017:Sall2 UTSW 14 52313262 missense possibly damaging 0.51
R9149:Sall2 UTSW 14 52313216 missense possibly damaging 0.95
R9362:Sall2 UTSW 14 52313144 nonsense probably null
R9571:Sall2 UTSW 14 52314373 missense probably damaging 1.00
R9574:Sall2 UTSW 14 52314160 missense probably damaging 1.00
R9641:Sall2 UTSW 14 52313425 missense probably damaging 1.00
R9648:Sall2 UTSW 14 52313767 missense probably damaging 1.00
R9694:Sall2 UTSW 14 52314667 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ATGAAGCTCTCAGGTTTCTGC -3'
(R):5'- AACTTACCGGAAGCCATGAAG -3'

Sequencing Primer
(F):5'- TGCTCTCTGAGTCATAGAGGACCAG -3'
(R):5'- TTACCGGAAGCCATGAAGAAGGATC -3'
Posted On 2020-09-02