Incidental Mutation 'R8324:Dnah5'
ID 644014
Institutional Source Beutler Lab
Gene Symbol Dnah5
Ensembl Gene ENSMUSG00000022262
Gene Name dynein, axonemal, heavy chain 5
Synonyms Dnahc5, b2b3491Clo, b2b1154Clo, b2b1134Clo, b2b1565Clo, b2b1537Clo, Mdnah5
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.791) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 28203898-28472198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 28347011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 2498 (R2498L)
Ref Sequence ENSEMBL: ENSMUSP00000069751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067048]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000067048
AA Change: R2498L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: R2498L

DomainStartEndE-ValueType
Pfam:DHC_N1 247 802 2.3e-163 PFAM
low complexity region 1077 1088 N/A INTRINSIC
low complexity region 1113 1128 N/A INTRINSIC
Pfam:DHC_N2 1399 1807 2.3e-134 PFAM
AAA 1972 2108 2e-3 SMART
AAA 2251 2424 4.3e-3 SMART
AAA 2579 2777 2.2e-3 SMART
low complexity region 2874 2889 N/A INTRINSIC
Pfam:AAA_8 2914 3186 3.2e-70 PFAM
Pfam:MT 3198 3546 1e-44 PFAM
Pfam:AAA_9 3567 3792 1.4e-86 PFAM
low complexity region 3889 3899 N/A INTRINSIC
Pfam:Dynein_heavy 3930 4618 4.4e-246 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Dnah5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dnah5 APN 15 28,272,488 (GRCm39) missense probably benign
IGL00331:Dnah5 APN 15 28,421,766 (GRCm39) missense probably damaging 1.00
IGL00519:Dnah5 APN 15 28,444,364 (GRCm39) missense probably benign 0.10
IGL00537:Dnah5 APN 15 28,458,848 (GRCm39) critical splice donor site probably null
IGL01102:Dnah5 APN 15 28,410,149 (GRCm39) critical splice donor site probably null
IGL01126:Dnah5 APN 15 28,302,545 (GRCm39) missense possibly damaging 0.85
IGL01154:Dnah5 APN 15 28,458,802 (GRCm39) missense possibly damaging 0.75
IGL01349:Dnah5 APN 15 28,295,059 (GRCm39) splice site probably benign
IGL01353:Dnah5 APN 15 28,233,418 (GRCm39) missense probably benign 0.00
IGL01372:Dnah5 APN 15 28,230,636 (GRCm39) missense probably benign 0.00
IGL01390:Dnah5 APN 15 28,411,686 (GRCm39) missense probably benign 0.00
IGL01446:Dnah5 APN 15 28,326,815 (GRCm39) missense probably damaging 1.00
IGL01472:Dnah5 APN 15 28,331,872 (GRCm39) missense probably damaging 1.00
IGL01485:Dnah5 APN 15 28,331,872 (GRCm39) missense probably damaging 1.00
IGL01568:Dnah5 APN 15 28,229,798 (GRCm39) missense probably benign 0.01
IGL01592:Dnah5 APN 15 28,236,783 (GRCm39) missense probably benign 0.01
IGL01594:Dnah5 APN 15 28,311,480 (GRCm39) missense possibly damaging 0.87
IGL01677:Dnah5 APN 15 28,367,928 (GRCm39) missense probably damaging 1.00
IGL01845:Dnah5 APN 15 28,449,315 (GRCm39) missense probably benign 0.06
IGL01904:Dnah5 APN 15 28,307,510 (GRCm39) missense probably benign 0.09
IGL01913:Dnah5 APN 15 28,313,899 (GRCm39) missense possibly damaging 0.50
IGL01950:Dnah5 APN 15 28,290,435 (GRCm39) missense probably null 1.00
IGL01963:Dnah5 APN 15 28,370,682 (GRCm39) missense probably benign 0.12
IGL02008:Dnah5 APN 15 28,343,698 (GRCm39) missense probably damaging 0.98
IGL02088:Dnah5 APN 15 28,459,264 (GRCm39) critical splice acceptor site probably null
IGL02090:Dnah5 APN 15 28,240,187 (GRCm39) splice site probably benign
IGL02114:Dnah5 APN 15 28,397,270 (GRCm39) missense probably damaging 0.97
IGL02135:Dnah5 APN 15 28,248,031 (GRCm39) missense possibly damaging 0.50
IGL02232:Dnah5 APN 15 28,299,386 (GRCm39) missense probably damaging 1.00
IGL02386:Dnah5 APN 15 28,340,527 (GRCm39) missense probably damaging 1.00
IGL02475:Dnah5 APN 15 28,219,296 (GRCm39) missense probably benign 0.09
IGL02626:Dnah5 APN 15 28,307,422 (GRCm39) missense possibly damaging 0.94
IGL02650:Dnah5 APN 15 28,289,193 (GRCm39) splice site probably benign
IGL02651:Dnah5 APN 15 28,350,768 (GRCm39) missense probably benign 0.05
IGL02652:Dnah5 APN 15 28,366,333 (GRCm39) missense probably damaging 0.99
IGL02670:Dnah5 APN 15 28,409,442 (GRCm39) missense probably damaging 1.00
IGL02697:Dnah5 APN 15 28,445,289 (GRCm39) missense probably benign 0.00
IGL02721:Dnah5 APN 15 28,234,389 (GRCm39) critical splice acceptor site probably null
IGL02858:Dnah5 APN 15 28,453,358 (GRCm39) missense possibly damaging 0.65
IGL02859:Dnah5 APN 15 28,383,771 (GRCm39) missense probably benign 0.01
IGL02945:Dnah5 APN 15 28,270,572 (GRCm39) missense probably benign 0.00
IGL02949:Dnah5 APN 15 28,272,331 (GRCm39) missense probably benign 0.32
IGL02971:Dnah5 APN 15 28,384,607 (GRCm39) missense probably damaging 1.00
IGL03017:Dnah5 APN 15 28,340,471 (GRCm39) missense possibly damaging 0.93
IGL03177:Dnah5 APN 15 28,295,545 (GRCm39) missense probably damaging 0.97
IGL03212:Dnah5 APN 15 28,290,309 (GRCm39) missense probably benign 0.08
IGL03224:Dnah5 APN 15 28,459,300 (GRCm39) missense probably damaging 1.00
IGL03231:Dnah5 APN 15 28,311,294 (GRCm39) missense probably damaging 1.00
IGL03273:Dnah5 APN 15 28,458,795 (GRCm39) missense probably damaging 0.98
IGL03294:Dnah5 APN 15 28,233,441 (GRCm39) critical splice donor site probably null
IGL03331:Dnah5 APN 15 28,420,086 (GRCm39) missense probably damaging 1.00
IGL03337:Dnah5 APN 15 28,290,287 (GRCm39) missense probably benign 0.10
IGL03367:Dnah5 APN 15 28,234,473 (GRCm39) missense possibly damaging 0.95
Firtel UTSW 15 28,448,513 (GRCm39) missense possibly damaging 0.95
lowbar UTSW 15 28,311,279 (GRCm39) splice site probably null
notherone UTSW 15 28,340,552 (GRCm39) missense probably benign 0.13
scheffler UTSW 15 28,438,237 (GRCm39) splice site probably benign
IGL02837:Dnah5 UTSW 15 28,269,546 (GRCm39) missense probably benign
P0008:Dnah5 UTSW 15 28,302,533 (GRCm39) missense probably damaging 1.00
P0014:Dnah5 UTSW 15 28,403,619 (GRCm39) missense probably damaging 1.00
PIT4687001:Dnah5 UTSW 15 28,383,723 (GRCm39) missense probably damaging 0.98
R0030:Dnah5 UTSW 15 28,451,663 (GRCm39) missense probably benign 0.34
R0087:Dnah5 UTSW 15 28,350,759 (GRCm39) missense probably damaging 1.00
R0099:Dnah5 UTSW 15 28,240,080 (GRCm39) missense probably damaging 1.00
R0102:Dnah5 UTSW 15 28,245,897 (GRCm39) splice site probably benign
R0102:Dnah5 UTSW 15 28,245,897 (GRCm39) splice site probably benign
R0104:Dnah5 UTSW 15 28,453,499 (GRCm39) missense possibly damaging 0.88
R0112:Dnah5 UTSW 15 28,263,825 (GRCm39) missense probably benign 0.00
R0122:Dnah5 UTSW 15 28,378,509 (GRCm39) missense probably damaging 1.00
R0126:Dnah5 UTSW 15 28,246,465 (GRCm39) missense probably benign 0.00
R0127:Dnah5 UTSW 15 28,295,071 (GRCm39) missense probably damaging 1.00
R0233:Dnah5 UTSW 15 28,333,216 (GRCm39) missense probably damaging 1.00
R0310:Dnah5 UTSW 15 28,299,256 (GRCm39) missense probably benign 0.19
R0386:Dnah5 UTSW 15 28,383,727 (GRCm39) missense probably damaging 1.00
R0421:Dnah5 UTSW 15 28,229,687 (GRCm39) missense possibly damaging 0.79
R0481:Dnah5 UTSW 15 28,383,745 (GRCm39) missense probably benign 0.31
R0514:Dnah5 UTSW 15 28,366,467 (GRCm39) missense probably damaging 1.00
R0609:Dnah5 UTSW 15 28,327,925 (GRCm39) missense probably benign
R0720:Dnah5 UTSW 15 28,314,007 (GRCm39) missense probably null 0.98
R0731:Dnah5 UTSW 15 28,311,289 (GRCm39) missense possibly damaging 0.78
R0747:Dnah5 UTSW 15 28,444,333 (GRCm39) missense possibly damaging 0.64
R0747:Dnah5 UTSW 15 28,444,332 (GRCm39) missense probably damaging 0.99
R0766:Dnah5 UTSW 15 28,448,633 (GRCm39) missense probably null 0.89
R0849:Dnah5 UTSW 15 28,263,745 (GRCm39) missense probably damaging 0.96
R1034:Dnah5 UTSW 15 28,302,617 (GRCm39) missense probably damaging 1.00
R1084:Dnah5 UTSW 15 28,343,598 (GRCm39) missense probably benign 0.01
R1148:Dnah5 UTSW 15 28,421,836 (GRCm39) missense probably damaging 1.00
R1148:Dnah5 UTSW 15 28,421,836 (GRCm39) missense probably damaging 1.00
R1200:Dnah5 UTSW 15 28,246,403 (GRCm39) missense possibly damaging 0.88
R1208:Dnah5 UTSW 15 28,327,877 (GRCm39) missense probably damaging 1.00
R1208:Dnah5 UTSW 15 28,327,877 (GRCm39) missense probably damaging 1.00
R1269:Dnah5 UTSW 15 28,238,657 (GRCm39) missense probably damaging 1.00
R1373:Dnah5 UTSW 15 28,314,064 (GRCm39) splice site probably benign
R1401:Dnah5 UTSW 15 28,402,059 (GRCm39) missense probably damaging 1.00
R1413:Dnah5 UTSW 15 28,370,555 (GRCm39) missense probably benign
R1430:Dnah5 UTSW 15 28,346,003 (GRCm39) missense probably benign 0.37
R1457:Dnah5 UTSW 15 28,403,688 (GRCm39) critical splice donor site probably null
R1468:Dnah5 UTSW 15 28,230,609 (GRCm39) nonsense probably null
R1468:Dnah5 UTSW 15 28,230,609 (GRCm39) nonsense probably null
R1560:Dnah5 UTSW 15 28,420,149 (GRCm39) missense probably damaging 1.00
R1568:Dnah5 UTSW 15 28,409,323 (GRCm39) missense probably damaging 0.98
R1574:Dnah5 UTSW 15 28,252,569 (GRCm39) missense probably benign 0.00
R1574:Dnah5 UTSW 15 28,252,569 (GRCm39) missense probably benign 0.00
R1603:Dnah5 UTSW 15 28,449,326 (GRCm39) missense probably benign 0.09
R1603:Dnah5 UTSW 15 28,295,131 (GRCm39) splice site probably benign
R1673:Dnah5 UTSW 15 28,290,294 (GRCm39) missense probably benign
R1755:Dnah5 UTSW 15 28,326,782 (GRCm39) missense probably damaging 0.99
R1785:Dnah5 UTSW 15 28,313,932 (GRCm39) missense probably damaging 1.00
R1786:Dnah5 UTSW 15 28,313,932 (GRCm39) missense probably damaging 1.00
R1789:Dnah5 UTSW 15 28,270,572 (GRCm39) missense probably benign 0.00
R1817:Dnah5 UTSW 15 28,246,546 (GRCm39) nonsense probably null
R1819:Dnah5 UTSW 15 28,246,546 (GRCm39) nonsense probably null
R1834:Dnah5 UTSW 15 28,409,270 (GRCm39) missense probably benign 0.00
R1855:Dnah5 UTSW 15 28,411,815 (GRCm39) missense possibly damaging 0.88
R1870:Dnah5 UTSW 15 28,331,859 (GRCm39) nonsense probably null
R1871:Dnah5 UTSW 15 28,331,859 (GRCm39) nonsense probably null
R1987:Dnah5 UTSW 15 28,343,737 (GRCm39) missense probably damaging 0.99
R1988:Dnah5 UTSW 15 28,343,737 (GRCm39) missense probably damaging 0.99
R1989:Dnah5 UTSW 15 28,343,737 (GRCm39) missense probably damaging 0.99
R2062:Dnah5 UTSW 15 28,366,416 (GRCm39) missense probably damaging 1.00
R2069:Dnah5 UTSW 15 28,312,534 (GRCm39) splice site probably null
R2121:Dnah5 UTSW 15 28,297,151 (GRCm39) splice site probably benign
R2128:Dnah5 UTSW 15 28,408,467 (GRCm39) missense probably benign 0.00
R2129:Dnah5 UTSW 15 28,408,467 (GRCm39) missense probably benign 0.00
R2151:Dnah5 UTSW 15 28,444,237 (GRCm39) missense probably damaging 1.00
R2159:Dnah5 UTSW 15 28,252,691 (GRCm39) missense probably benign 0.00
R2207:Dnah5 UTSW 15 28,343,817 (GRCm39) missense probably benign 0.11
R2231:Dnah5 UTSW 15 28,408,563 (GRCm39) critical splice donor site probably null
R2232:Dnah5 UTSW 15 28,408,563 (GRCm39) critical splice donor site probably null
R2282:Dnah5 UTSW 15 28,327,448 (GRCm39) missense probably damaging 0.99
R2305:Dnah5 UTSW 15 28,387,913 (GRCm39) missense probably benign 0.25
R2339:Dnah5 UTSW 15 28,314,028 (GRCm39) missense probably benign 0.00
R2437:Dnah5 UTSW 15 28,307,537 (GRCm39) critical splice donor site probably null
R2696:Dnah5 UTSW 15 28,278,722 (GRCm39) missense probably benign 0.00
R3156:Dnah5 UTSW 15 28,438,237 (GRCm39) splice site probably benign
R3431:Dnah5 UTSW 15 28,295,413 (GRCm39) missense probably benign 0.20
R3700:Dnah5 UTSW 15 28,387,937 (GRCm39) missense possibly damaging 0.72
R3724:Dnah5 UTSW 15 28,270,566 (GRCm39) missense probably benign 0.08
R3732:Dnah5 UTSW 15 28,409,268 (GRCm39) missense possibly damaging 0.64
R3872:Dnah5 UTSW 15 28,411,656 (GRCm39) missense possibly damaging 0.50
R4063:Dnah5 UTSW 15 28,421,144 (GRCm39) missense probably damaging 0.98
R4072:Dnah5 UTSW 15 28,340,444 (GRCm39) nonsense probably null
R4075:Dnah5 UTSW 15 28,293,937 (GRCm39) missense probably benign
R4245:Dnah5 UTSW 15 28,219,335 (GRCm39) missense probably benign
R4254:Dnah5 UTSW 15 28,438,248 (GRCm39) missense probably benign 0.07
R4255:Dnah5 UTSW 15 28,438,248 (GRCm39) missense probably benign 0.07
R4392:Dnah5 UTSW 15 28,289,375 (GRCm39) missense probably benign 0.19
R4552:Dnah5 UTSW 15 28,397,300 (GRCm39) missense probably benign 0.19
R4574:Dnah5 UTSW 15 28,367,909 (GRCm39) missense probably benign 0.05
R4577:Dnah5 UTSW 15 28,289,396 (GRCm39) missense probably benign 0.06
R4587:Dnah5 UTSW 15 28,304,745 (GRCm39) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,420,140 (GRCm39) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,402,099 (GRCm39) missense probably damaging 1.00
R4676:Dnah5 UTSW 15 28,295,406 (GRCm39) missense possibly damaging 0.65
R4707:Dnah5 UTSW 15 28,372,521 (GRCm39) missense probably damaging 0.97
R4754:Dnah5 UTSW 15 28,421,101 (GRCm39) splice site probably null
R4767:Dnah5 UTSW 15 28,270,620 (GRCm39) missense probably benign 0.02
R4857:Dnah5 UTSW 15 28,345,953 (GRCm39) missense probably benign 0.00
R4883:Dnah5 UTSW 15 28,343,784 (GRCm39) missense probably benign 0.00
R4889:Dnah5 UTSW 15 28,235,938 (GRCm39) missense probably benign 0.01
R4946:Dnah5 UTSW 15 28,388,050 (GRCm39) missense probably damaging 1.00
R4946:Dnah5 UTSW 15 28,326,703 (GRCm39) missense probably damaging 0.96
R4947:Dnah5 UTSW 15 28,272,518 (GRCm39) missense probably benign
R5033:Dnah5 UTSW 15 28,421,824 (GRCm39) missense probably damaging 0.96
R5164:Dnah5 UTSW 15 28,408,438 (GRCm39) missense probably benign 0.00
R5175:Dnah5 UTSW 15 28,448,550 (GRCm39) missense probably damaging 1.00
R5182:Dnah5 UTSW 15 28,311,424 (GRCm39) missense probably damaging 0.99
R5187:Dnah5 UTSW 15 28,272,318 (GRCm39) missense probably benign 0.41
R5272:Dnah5 UTSW 15 28,350,811 (GRCm39) missense probably benign
R5308:Dnah5 UTSW 15 28,229,797 (GRCm39) missense possibly damaging 0.80
R5310:Dnah5 UTSW 15 28,311,474 (GRCm39) missense probably damaging 1.00
R5322:Dnah5 UTSW 15 28,384,390 (GRCm39) missense probably benign 0.41
R5398:Dnah5 UTSW 15 28,293,872 (GRCm39) missense probably benign
R5596:Dnah5 UTSW 15 28,343,754 (GRCm39) missense probably damaging 1.00
R5603:Dnah5 UTSW 15 28,420,078 (GRCm39) missense probably damaging 1.00
R5619:Dnah5 UTSW 15 28,302,581 (GRCm39) missense probably damaging 1.00
R5656:Dnah5 UTSW 15 28,421,210 (GRCm39) missense probably benign 0.03
R5741:Dnah5 UTSW 15 28,246,513 (GRCm39) missense probably benign 0.11
R5754:Dnah5 UTSW 15 28,402,014 (GRCm39) missense probably benign 0.01
R5763:Dnah5 UTSW 15 28,311,298 (GRCm39) missense probably damaging 1.00
R5824:Dnah5 UTSW 15 28,313,967 (GRCm39) missense probably benign 0.00
R5836:Dnah5 UTSW 15 28,383,738 (GRCm39) missense probably damaging 1.00
R5838:Dnah5 UTSW 15 28,290,341 (GRCm39) missense probably benign 0.00
R5864:Dnah5 UTSW 15 28,297,159 (GRCm39) missense possibly damaging 0.83
R5895:Dnah5 UTSW 15 28,234,599 (GRCm39) splice site probably null
R5896:Dnah5 UTSW 15 28,272,206 (GRCm39) missense probably benign
R5899:Dnah5 UTSW 15 28,448,513 (GRCm39) missense possibly damaging 0.95
R5905:Dnah5 UTSW 15 28,387,979 (GRCm39) missense probably damaging 1.00
R5924:Dnah5 UTSW 15 28,307,473 (GRCm39) missense probably benign 0.41
R5927:Dnah5 UTSW 15 28,335,864 (GRCm39) missense probably benign 0.00
R5929:Dnah5 UTSW 15 28,311,354 (GRCm39) missense probably damaging 1.00
R5929:Dnah5 UTSW 15 28,311,353 (GRCm39) missense probably benign 0.01
R5931:Dnah5 UTSW 15 28,453,425 (GRCm39) missense probably damaging 0.99
R5964:Dnah5 UTSW 15 28,458,730 (GRCm39) missense possibly damaging 0.49
R5975:Dnah5 UTSW 15 28,234,428 (GRCm39) missense probably damaging 1.00
R5993:Dnah5 UTSW 15 28,299,372 (GRCm39) missense probably benign 0.09
R6016:Dnah5 UTSW 15 28,328,030 (GRCm39) missense probably damaging 1.00
R6028:Dnah5 UTSW 15 28,387,979 (GRCm39) missense probably damaging 1.00
R6065:Dnah5 UTSW 15 28,230,614 (GRCm39) missense possibly damaging 0.47
R6117:Dnah5 UTSW 15 28,270,566 (GRCm39) missense probably damaging 0.99
R6143:Dnah5 UTSW 15 28,233,377 (GRCm39) missense probably benign 0.05
R6146:Dnah5 UTSW 15 28,459,331 (GRCm39) missense probably benign
R6154:Dnah5 UTSW 15 28,204,177 (GRCm39) missense probably benign 0.15
R6164:Dnah5 UTSW 15 28,378,489 (GRCm39) missense probably benign 0.08
R6266:Dnah5 UTSW 15 28,335,773 (GRCm39) missense possibly damaging 0.67
R6321:Dnah5 UTSW 15 28,372,557 (GRCm39) missense probably damaging 0.99
R6349:Dnah5 UTSW 15 28,238,657 (GRCm39) missense probably damaging 1.00
R6431:Dnah5 UTSW 15 28,349,970 (GRCm39) missense possibly damaging 0.52
R6467:Dnah5 UTSW 15 28,438,329 (GRCm39) missense probably benign 0.10
R6564:Dnah5 UTSW 15 28,367,891 (GRCm39) missense probably benign
R6607:Dnah5 UTSW 15 28,445,346 (GRCm39) missense possibly damaging 0.95
R6619:Dnah5 UTSW 15 28,409,266 (GRCm39) missense probably benign 0.03
R6633:Dnah5 UTSW 15 28,293,933 (GRCm39) missense probably benign 0.27
R6647:Dnah5 UTSW 15 28,403,633 (GRCm39) missense probably benign 0.02
R6782:Dnah5 UTSW 15 28,449,302 (GRCm39) missense possibly damaging 0.89
R6797:Dnah5 UTSW 15 28,233,384 (GRCm39) nonsense probably null
R6797:Dnah5 UTSW 15 28,451,609 (GRCm39) missense probably damaging 1.00
R6831:Dnah5 UTSW 15 28,411,661 (GRCm39) missense possibly damaging 0.88
R6849:Dnah5 UTSW 15 28,278,770 (GRCm39) missense probably benign 0.14
R6871:Dnah5 UTSW 15 28,229,786 (GRCm39) missense probably benign 0.32
R6936:Dnah5 UTSW 15 28,409,414 (GRCm39) missense probably damaging 1.00
R6943:Dnah5 UTSW 15 28,235,866 (GRCm39) missense probably damaging 1.00
R7030:Dnah5 UTSW 15 28,333,208 (GRCm39) missense probably benign 0.00
R7030:Dnah5 UTSW 15 28,238,738 (GRCm39) missense probably benign
R7032:Dnah5 UTSW 15 28,326,796 (GRCm39) missense probably damaging 1.00
R7063:Dnah5 UTSW 15 28,233,394 (GRCm39) missense probably benign 0.00
R7094:Dnah5 UTSW 15 28,453,482 (GRCm39) missense probably damaging 0.98
R7097:Dnah5 UTSW 15 28,453,410 (GRCm39) missense probably benign 0.00
R7126:Dnah5 UTSW 15 28,349,983 (GRCm39) missense probably benign 0.03
R7153:Dnah5 UTSW 15 28,365,668 (GRCm39) splice site probably null
R7209:Dnah5 UTSW 15 28,459,371 (GRCm39) missense possibly damaging 0.71
R7276:Dnah5 UTSW 15 28,367,984 (GRCm39) missense probably damaging 1.00
R7320:Dnah5 UTSW 15 28,270,616 (GRCm39) missense probably null 0.33
R7350:Dnah5 UTSW 15 28,235,965 (GRCm39) critical splice donor site probably null
R7380:Dnah5 UTSW 15 28,370,524 (GRCm39) missense probably damaging 1.00
R7438:Dnah5 UTSW 15 28,347,098 (GRCm39) missense probably damaging 0.99
R7499:Dnah5 UTSW 15 28,302,596 (GRCm39) missense probably damaging 1.00
R7513:Dnah5 UTSW 15 28,370,561 (GRCm39) missense probably benign
R7519:Dnah5 UTSW 15 28,390,629 (GRCm39) missense probably damaging 0.98
R7524:Dnah5 UTSW 15 28,297,212 (GRCm39) missense possibly damaging 0.50
R7556:Dnah5 UTSW 15 28,290,389 (GRCm39) missense probably null 0.43
R7570:Dnah5 UTSW 15 28,347,098 (GRCm39) missense probably damaging 1.00
R7585:Dnah5 UTSW 15 28,402,014 (GRCm39) missense probably benign 0.09
R7642:Dnah5 UTSW 15 28,248,125 (GRCm39) critical splice donor site probably null
R7670:Dnah5 UTSW 15 28,246,378 (GRCm39) splice site probably null
R7763:Dnah5 UTSW 15 28,314,001 (GRCm39) missense probably damaging 1.00
R7821:Dnah5 UTSW 15 28,411,678 (GRCm39) missense possibly damaging 0.89
R7826:Dnah5 UTSW 15 28,367,958 (GRCm39) missense probably damaging 1.00
R7872:Dnah5 UTSW 15 28,245,830 (GRCm39) missense probably damaging 0.99
R7889:Dnah5 UTSW 15 28,448,560 (GRCm39) nonsense probably null
R7919:Dnah5 UTSW 15 28,350,742 (GRCm39) missense probably damaging 1.00
R7920:Dnah5 UTSW 15 28,453,368 (GRCm39) missense probably benign 0.00
R7936:Dnah5 UTSW 15 28,345,983 (GRCm39) missense possibly damaging 0.64
R7996:Dnah5 UTSW 15 28,409,323 (GRCm39) missense probably damaging 0.98
R8063:Dnah5 UTSW 15 28,230,729 (GRCm39) missense probably benign
R8084:Dnah5 UTSW 15 28,388,099 (GRCm39) missense probably damaging 1.00
R8105:Dnah5 UTSW 15 28,372,548 (GRCm39) missense probably benign
R8114:Dnah5 UTSW 15 28,240,122 (GRCm39) missense probably benign 0.01
R8142:Dnah5 UTSW 15 28,384,519 (GRCm39) missense probably benign 0.36
R8153:Dnah5 UTSW 15 28,384,576 (GRCm39) missense probably damaging 1.00
R8161:Dnah5 UTSW 15 28,350,850 (GRCm39) missense possibly damaging 0.79
R8174:Dnah5 UTSW 15 28,311,279 (GRCm39) splice site probably null
R8187:Dnah5 UTSW 15 28,384,355 (GRCm39) missense probably damaging 1.00
R8194:Dnah5 UTSW 15 28,453,414 (GRCm39) missense probably damaging 0.99
R8280:Dnah5 UTSW 15 28,408,538 (GRCm39) missense probably benign 0.01
R8291:Dnah5 UTSW 15 28,263,743 (GRCm39) missense probably benign 0.03
R8347:Dnah5 UTSW 15 28,236,812 (GRCm39) missense possibly damaging 0.90
R8356:Dnah5 UTSW 15 28,444,313 (GRCm39) missense probably benign 0.03
R8356:Dnah5 UTSW 15 28,444,469 (GRCm39) missense probably null 0.02
R8361:Dnah5 UTSW 15 28,331,956 (GRCm39) missense probably damaging 0.98
R8375:Dnah5 UTSW 15 28,327,489 (GRCm39) missense probably benign 0.00
R8474:Dnah5 UTSW 15 28,247,978 (GRCm39) missense probably benign 0.00
R8481:Dnah5 UTSW 15 28,419,941 (GRCm39) missense probably benign 0.00
R8494:Dnah5 UTSW 15 28,345,977 (GRCm39) missense probably benign 0.32
R8495:Dnah5 UTSW 15 28,409,414 (GRCm39) missense probably damaging 0.97
R8519:Dnah5 UTSW 15 28,299,245 (GRCm39) missense probably benign 0.07
R8683:Dnah5 UTSW 15 28,289,367 (GRCm39) missense probably benign 0.00
R8739:Dnah5 UTSW 15 28,346,006 (GRCm39) missense probably benign 0.01
R8752:Dnah5 UTSW 15 28,290,365 (GRCm39) missense probably benign 0.00
R8784:Dnah5 UTSW 15 28,388,097 (GRCm39) missense probably benign 0.16
R8813:Dnah5 UTSW 15 28,229,719 (GRCm39) missense probably damaging 1.00
R8862:Dnah5 UTSW 15 28,459,502 (GRCm39) splice site probably benign
R8873:Dnah5 UTSW 15 28,219,334 (GRCm39) missense probably benign
R8885:Dnah5 UTSW 15 28,327,886 (GRCm39) missense probably damaging 1.00
R8901:Dnah5 UTSW 15 28,365,715 (GRCm39) missense possibly damaging 0.76
R9025:Dnah5 UTSW 15 28,409,412 (GRCm39) missense probably damaging 1.00
R9037:Dnah5 UTSW 15 28,248,104 (GRCm39) missense probably benign 0.05
R9057:Dnah5 UTSW 15 28,391,014 (GRCm39) missense probably damaging 1.00
R9059:Dnah5 UTSW 15 28,245,812 (GRCm39) missense probably benign
R9065:Dnah5 UTSW 15 28,293,936 (GRCm39) missense probably benign 0.09
R9098:Dnah5 UTSW 15 28,420,107 (GRCm39) missense
R9118:Dnah5 UTSW 15 28,401,994 (GRCm39) frame shift probably null
R9149:Dnah5 UTSW 15 28,387,914 (GRCm39) missense probably benign 0.00
R9184:Dnah5 UTSW 15 28,340,552 (GRCm39) missense probably benign 0.13
R9205:Dnah5 UTSW 15 28,448,480 (GRCm39) missense possibly damaging 0.88
R9297:Dnah5 UTSW 15 28,204,054 (GRCm39) start gained probably benign
R9302:Dnah5 UTSW 15 28,240,032 (GRCm39) missense probably benign 0.03
R9310:Dnah5 UTSW 15 28,448,579 (GRCm39) missense probably damaging 1.00
R9318:Dnah5 UTSW 15 28,204,054 (GRCm39) start gained probably benign
R9405:Dnah5 UTSW 15 28,272,306 (GRCm39) missense probably benign
R9424:Dnah5 UTSW 15 28,272,286 (GRCm39) missense probably benign 0.01
R9467:Dnah5 UTSW 15 28,366,293 (GRCm39) missense possibly damaging 0.94
R9469:Dnah5 UTSW 15 28,421,146 (GRCm39) missense probably benign 0.06
R9548:Dnah5 UTSW 15 28,328,025 (GRCm39) missense possibly damaging 0.79
R9564:Dnah5 UTSW 15 28,290,422 (GRCm39) missense probably benign 0.04
R9576:Dnah5 UTSW 15 28,272,286 (GRCm39) missense probably benign 0.01
R9593:Dnah5 UTSW 15 28,236,774 (GRCm39) missense probably benign
R9644:Dnah5 UTSW 15 28,230,650 (GRCm39) missense probably damaging 0.98
R9655:Dnah5 UTSW 15 28,242,900 (GRCm39) missense probably benign
R9657:Dnah5 UTSW 15 28,410,089 (GRCm39) missense probably damaging 1.00
R9704:Dnah5 UTSW 15 28,247,965 (GRCm39) missense probably benign 0.00
R9797:Dnah5 UTSW 15 28,233,316 (GRCm39) missense probably benign 0.34
RF009:Dnah5 UTSW 15 28,204,165 (GRCm39) missense probably benign 0.00
X0011:Dnah5 UTSW 15 28,408,527 (GRCm39) missense probably benign 0.16
X0018:Dnah5 UTSW 15 28,269,500 (GRCm39) missense probably benign 0.00
X0022:Dnah5 UTSW 15 28,270,557 (GRCm39) missense probably benign 0.01
X0023:Dnah5 UTSW 15 28,384,454 (GRCm39) missense probably damaging 0.99
X0028:Dnah5 UTSW 15 28,470,623 (GRCm39) missense probably damaging 1.00
Z1088:Dnah5 UTSW 15 28,366,503 (GRCm39) missense probably null 0.10
Z1088:Dnah5 UTSW 15 28,384,376 (GRCm39) missense probably damaging 1.00
Z1177:Dnah5 UTSW 15 28,295,457 (GRCm39) missense probably damaging 0.98
Z1177:Dnah5 UTSW 15 28,270,549 (GRCm39) missense probably benign 0.00
Z1177:Dnah5 UTSW 15 28,270,500 (GRCm39) missense probably benign 0.32
Z1177:Dnah5 UTSW 15 28,387,909 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TATAAACCAGTTAGCACCCCTGG -3'
(R):5'- ACCCGAGCATTTTAATTCTCAC -3'

Sequencing Primer
(F):5'- GGGGACAGCTCATATCATTTTCCTAG -3'
(R):5'- CTTTAATAACCCAACCCATCCTTG -3'
Posted On 2020-09-02