Incidental Mutation 'R8324:Pdzrn4'
ID 644016
Institutional Source Beutler Lab
Gene Symbol Pdzrn4
Ensembl Gene ENSMUSG00000036218
Gene Name PDZ domain containing RING finger 4
Synonyms 1110017D07Rik, SAMCAP3L, LNX4
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 92294762-92669700 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92668818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 990 (E990G)
Ref Sequence ENSEMBL: ENSMUSP00000133159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]
AlphaFold E9PUZ9
Predicted Effect probably damaging
Transcript: ENSMUST00000035399
AA Change: E751G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: E751G

DomainStartEndE-ValueType
Blast:PDZ 1 56 4e-24 BLAST
SCOP:d1qaua_ 20 61 1e-3 SMART
PDB:1UHP|A 21 64 9e-12 PDB
PDZ 154 229 3.01e-18 SMART
low complexity region 240 259 N/A INTRINSIC
low complexity region 267 278 N/A INTRINSIC
coiled coil region 394 430 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169942
AA Change: E990G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: E990G

DomainStartEndE-ValueType
RING 22 56 1.38e-1 SMART
low complexity region 101 124 N/A INTRINSIC
PDZ 213 295 3.82e-20 SMART
PDZ 393 468 3.01e-18 SMART
low complexity region 479 498 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
coiled coil region 633 669 N/A INTRINSIC
low complexity region 802 816 N/A INTRINSIC
low complexity region 935 948 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Pdzrn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Pdzrn4 APN 15 92,644,159 (GRCm39) missense probably damaging 1.00
IGL01991:Pdzrn4 APN 15 92,299,807 (GRCm39) splice site probably null
IGL02103:Pdzrn4 APN 15 92,667,768 (GRCm39) missense probably damaging 1.00
IGL02243:Pdzrn4 APN 15 92,668,577 (GRCm39) missense probably benign 0.30
IGL02269:Pdzrn4 APN 15 92,667,731 (GRCm39) missense probably damaging 1.00
IGL03005:Pdzrn4 APN 15 92,668,272 (GRCm39) missense probably damaging 1.00
PIT4362001:Pdzrn4 UTSW 15 92,667,762 (GRCm39) missense possibly damaging 0.46
R0243:Pdzrn4 UTSW 15 92,668,200 (GRCm39) missense possibly damaging 0.46
R0367:Pdzrn4 UTSW 15 92,655,538 (GRCm39) missense possibly damaging 0.53
R0972:Pdzrn4 UTSW 15 92,655,592 (GRCm39) missense probably benign 0.00
R1168:Pdzrn4 UTSW 15 92,668,152 (GRCm39) missense probably benign 0.16
R1411:Pdzrn4 UTSW 15 92,668,894 (GRCm39) makesense probably null
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1489:Pdzrn4 UTSW 15 92,575,593 (GRCm39) missense probably benign
R1503:Pdzrn4 UTSW 15 92,297,685 (GRCm39) missense probably damaging 0.99
R1561:Pdzrn4 UTSW 15 92,575,518 (GRCm39) missense possibly damaging 0.84
R1584:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1733:Pdzrn4 UTSW 15 92,299,855 (GRCm39) missense probably benign 0.06
R1965:Pdzrn4 UTSW 15 92,644,190 (GRCm39) splice site probably null
R2061:Pdzrn4 UTSW 15 92,668,041 (GRCm39) missense probably damaging 0.99
R3010:Pdzrn4 UTSW 15 92,667,692 (GRCm39) missense probably benign 0.32
R4016:Pdzrn4 UTSW 15 92,297,630 (GRCm39) missense probably benign
R4032:Pdzrn4 UTSW 15 92,667,414 (GRCm39) missense probably damaging 1.00
R4110:Pdzrn4 UTSW 15 92,668,745 (GRCm39) missense probably benign 0.26
R4180:Pdzrn4 UTSW 15 92,299,898 (GRCm39) missense possibly damaging 0.93
R4539:Pdzrn4 UTSW 15 92,668,470 (GRCm39) missense probably damaging 1.00
R4617:Pdzrn4 UTSW 15 92,667,723 (GRCm39) missense probably damaging 1.00
R4734:Pdzrn4 UTSW 15 92,668,133 (GRCm39) nonsense probably null
R4900:Pdzrn4 UTSW 15 92,668,638 (GRCm39) missense probably damaging 1.00
R5422:Pdzrn4 UTSW 15 92,575,502 (GRCm39) missense probably benign 0.01
R5444:Pdzrn4 UTSW 15 92,668,806 (GRCm39) missense probably damaging 1.00
R5772:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R5775:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R5935:Pdzrn4 UTSW 15 92,295,255 (GRCm39) missense probably benign 0.01
R6192:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6210:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6258:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6259:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6391:Pdzrn4 UTSW 15 92,578,418 (GRCm39) missense probably damaging 0.99
R6613:Pdzrn4 UTSW 15 92,575,455 (GRCm39) missense probably damaging 0.99
R7046:Pdzrn4 UTSW 15 92,668,303 (GRCm39) nonsense probably null
R7096:Pdzrn4 UTSW 15 92,295,384 (GRCm39) missense probably benign 0.00
R7451:Pdzrn4 UTSW 15 92,667,948 (GRCm39) missense possibly damaging 0.68
R8075:Pdzrn4 UTSW 15 92,575,605 (GRCm39) missense probably damaging 0.99
R8125:Pdzrn4 UTSW 15 92,641,476 (GRCm39) missense probably damaging 1.00
R9332:Pdzrn4 UTSW 15 92,295,216 (GRCm39) missense probably benign
R9555:Pdzrn4 UTSW 15 92,297,703 (GRCm39) missense probably damaging 1.00
R9558:Pdzrn4 UTSW 15 92,299,877 (GRCm39) missense possibly damaging 0.46
R9622:Pdzrn4 UTSW 15 92,294,949 (GRCm39) missense probably benign
R9763:Pdzrn4 UTSW 15 92,668,376 (GRCm39) missense probably damaging 1.00
R9796:Pdzrn4 UTSW 15 92,578,353 (GRCm39) missense possibly damaging 0.93
X0018:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0020:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0021:Pdzrn4 UTSW 15 92,575,590 (GRCm39) missense probably damaging 1.00
X0026:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92,578,393 (GRCm39) missense possibly damaging 0.92
X0027:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0065:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
Z1176:Pdzrn4 UTSW 15 92,294,838 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAAAGCAACACCTGGTCCG -3'
(R):5'- CCAAAGAAGGTACCAGCCTATG -3'

Sequencing Primer
(F):5'- TCCGGGCCAAGGAGCAAAG -3'
(R):5'- CACCGACAGAAAGGCATT -3'
Posted On 2020-09-02