Mutagenetix > Incidental Mutation

Incidental Mutation 'R8324:Trp63'

644019

Institutional Source

Beutler Lab

Gene Symbol

Trp63

Ensembl Gene

ENSMUSG00000022510

Gene Name

transformation related protein 63

Synonyms

TAp63, deltaNp63, p63, p73L, p51/p63, KET protein, Trp53rp1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.866) question?

Stock #

R8324 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

25683763-25892102 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25876734 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 482 (Y482C)

Ref Sequence

ENSEMBL: ENSMUSP00000110963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040231] [ENSMUST00000065523] [ENSMUST00000115305] [ENSMUST00000115306] [ENSMUST00000115308] [ENSMUST00000115310]

AlphaFold

O88898

Predicted Effect

probably benign
Transcript: ENSMUST00000040231

SMART Domains

Protein: ENSMUSP00000038117
Gene: ENSMUSG00000022510

Domain	Start	End	E-Value	Type
Pfam:P53	69	265	5.4e-110	PFAM
Pfam:P53_tetramer	297	338	2.4e-20	PFAM
low complexity region	343	356	N/A	INTRINSIC
low complexity region	358	369	N/A	INTRINSIC
SAM	447	513	1.4e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000065523

SMART Domains

Protein: ENSMUSP00000067005
Gene: ENSMUSG00000022510

Domain	Start	End	E-Value	Type
Pfam:P53	163	359	4.9e-110	PFAM
Pfam:P53_tetramer	391	432	2.2e-20	PFAM
low complexity region	437	450	N/A	INTRINSIC
low complexity region	452	463	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000115305
AA Change: Y392C

SMART Domains

Protein: ENSMUSP00000110960
Gene: ENSMUSG00000022510
AA Change: Y392C

Domain	Start	End	E-Value	Type
Pfam:P53	69	265	1.1e-110	PFAM
Pfam:P53_tetramer	297	338	5.5e-21	PFAM
low complexity region	343	358	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115306

SMART Domains

Protein: ENSMUSP00000110961
Gene: ENSMUSG00000022510

Domain	Start	End	E-Value	Type
Pfam:P53	69	265	2.7e-110	PFAM
Pfam:P53_tetramer	293	334	9.2e-21	PFAM
low complexity region	339	352	N/A	INTRINSIC
low complexity region	354	365	N/A	INTRINSIC
SAM	443	509	1.4e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000115308
AA Change: Y482C

SMART Domains

Protein: ENSMUSP00000110963
Gene: ENSMUSG00000022510
AA Change: Y482C

Domain	Start	End	E-Value	Type
Pfam:P53	163	359	3.6e-110	PFAM
Pfam:P53_tetramer	387	428	1.8e-20	PFAM
low complexity region	433	448	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115310

SMART Domains

Protein: ENSMUSP00000110965
Gene: ENSMUSG00000022510

Domain	Start	End	E-Value	Type
Pfam:P53	163	359	1.3e-112	PFAM
Pfam:P53_tetramer	391	431	7e-21	PFAM
low complexity region	437	450	N/A	INTRINSIC
low complexity region	452	463	N/A	INTRINSIC
SAM	541	607	1.4e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes tumor protein p63, a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include tumor proteins p53, p63, and p73, which have high sequence similarity to one another. This similarity allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways, including direct and indirect protein interactions. This results in mutual regulation of target gene promoters. Tumor protein p63 -/- mice have several developmental defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Both alternative splicing and the use of alternative promoters result in multiple transcript variants encoding different protein isoforms.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygotes for null mutations lack hair follicles, teeth, eyelids, and all squamous epithelia and derivatives including mammary, lacrymal, salivary, and prostate glands. Mutants have craniofacial anomalies, missing or truncated limbs, and small genitalia, and they die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,290,395	S753P	probably damaging	Het
Acan	A	G	7: 79,091,056	E390G	probably damaging	Het
Antxr2	T	C	5: 97,938,509	N413S	probably damaging	Het
Bace2	C	T	16: 97,356,908	A36V	possibly damaging	Het
Caprin1	G	A	2: 103,783,181	R79*	probably null	Het
Cdan1	A	G	2: 120,727,325	V507A	probably benign	Het
Cdkl3	T	A	11: 52,022,879		probably null	Het
Chst5	A	T	8: 111,890,508	L160Q	probably benign	Het
Col11a1	C	G	3: 114,164,410	P1111R	probably damaging	Het
Col6a6	T	A	9: 105,755,654	E1470D	probably benign	Het
Cpped1	T	A	16: 11,805,476	T274S	probably benign	Het
Ctnnbl1	G	A	2: 157,779,815	E75K	probably damaging	Het
Cyp4f40	T	C	17: 32,659,528	S15P	probably benign	Het
Ddx46	T	C	13: 55,663,914	S643P	probably damaging	Het
Defb34	A	G	8: 19,123,798	Q16R	probably null	Het
Dhrs2	T	A	14: 55,238,764	V147E	probably damaging	Het
Dnah5	G	T	15: 28,346,865	R2498L	probably damaging	Het
Dpp10	T	A	1: 123,854,172	I93F	probably benign	Het
Eef1e1	T	A	13: 38,655,069	D104V	probably damaging	Het
Egfr	A	G	11: 16,858,971	Y55C	probably damaging	Het
Egfr	A	C	11: 16,908,885	I955L	probably damaging	Het
Ehbp1l1	C	A	19: 5,719,998	V426F	possibly damaging	Het
Fam234a	C	T	17: 26,218,698	V108I	probably benign	Het
Fzd8	T	A	18: 9,214,688	M590K	probably damaging	Het
Gm13287	T	C	4: 88,803,638	S129P	probably damaging	Het
Heatr5b	A	G	17: 78,755,364	S1919P	possibly damaging	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Ikbkap	C	T	4: 56,772,491	E877K	probably damaging	Het
Itpr2	T	C	6: 146,328,398	E1233G	probably damaging	Het
Kcnmb4	A	G	10: 116,418,314	L186P	probably damaging	Het
Krt72	T	A	15: 101,782,145	Y224F	probably damaging	Het
Loxhd1	T	C	18: 77,339,579		probably null	Het
Lrguk	A	G	6: 34,102,571	T914A	probably benign	Het
Lrrtm4	A	G	6: 80,021,991	T129A	probably damaging	Het
Mmp13	A	T	9: 7,276,636	I244F	possibly damaging	Het
Mob1a	T	A	6: 83,329,974	L41Q	probably damaging	Het
Mtcl1	T	C	17: 66,436,217	R426G	probably damaging	Het
Mybbp1a	T	C	11: 72,445,288		probably null	Het
Myh9	A	G	15: 77,788,917		probably null	Het
Myo1d	T	A	11: 80,557,521	D926V	probably damaging	Het
Ncapg	T	G	5: 45,695,668	H825Q	probably damaging	Het
Olfml1	T	C	7: 107,590,363	S212P	probably benign	Het
Olfr656	G	A	7: 104,618,114	R145H	probably benign	Het
Pak2	T	C	16: 32,052,211	N51S	probably benign	Het
Papln	T	C	12: 83,786,619	Y1132H	probably damaging	Het
Pax3	T	A	1: 78,193,789	R134S	probably damaging	Het
Pdzrn4	A	G	15: 92,770,937	E990G	probably damaging	Het
Peak1	A	T	9: 56,207,476	W1394R	probably damaging	Het
Pkn2	T	C	3: 142,829,010	N285D	probably benign	Het
Pramef12	A	C	4: 144,395,857	L39R	probably damaging	Het
Prrc2a	A	G	17: 35,156,984	S897P	possibly damaging	Het
Rad51	A	G	2: 119,123,831	T131A	possibly damaging	Het
Rc3h2	T	A	2: 37,400,726	T255S	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rictor	T	A	15: 6,745,562	V125E	probably damaging	Het
Rps6ka5	C	T	12: 100,558,487	D664N	possibly damaging	Het
Rreb1	T	A	13: 37,947,621	W1584R	probably damaging	Het
Rxra	T	C	2: 27,741,183	I142T	probably damaging	Het
Sall2	T	C	14: 52,312,886	T951A	probably benign	Het
Slc15a2	T	G	16: 36,759,307	N359T	probably damaging	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Slc6a13	T	C	6: 121,337,414	*603Q	probably null	Het
Sptb	T	C	12: 76,619,162	D894G	possibly damaging	Het
Srgn	A	G	10: 62,507,665	L17P	probably damaging	Het
Tmprss9	T	C	10: 80,897,371		probably null	Het
Trav9n-4	T	C	14: 53,294,946	F86L	probably benign	Het
Ttc9b	G	T	7: 27,653,969	A15S	probably damaging	Het
Urb1	A	T	16: 90,791,190	I410N	probably damaging	Het
Vmn2r82	A	T	10: 79,378,893	K237*	probably null	Het
Wwox	G	A	8: 114,489,005		probably null	Het

Other mutations in Trp63

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00935:Trp63	APN	16	25871076	missense	probably damaging	1.00
IGL01402:Trp63	APN	16	25820385	splice site	probably benign
IGL01404:Trp63	APN	16	25820385	splice site	probably benign
IGL01874:Trp63	APN	16	25882585	missense	possibly damaging	0.88
IGL01887:Trp63	APN	16	25865319	missense	probably damaging	1.00
IGL02008:Trp63	APN	16	25862461	missense	probably damaging	1.00
IGL02336:Trp63	APN	16	25820442	missense	probably damaging	1.00
IGL02470:Trp63	APN	16	25820384	splice site	probably benign
IGL02720:Trp63	APN	16	25863741	missense	probably damaging	0.96
IGL03230:Trp63	APN	16	25889010	missense	probably damaging	1.00
PIT4142001:Trp63	UTSW	16	25865263	missense	probably damaging	1.00
R0086:Trp63	UTSW	16	25871087	missense	probably damaging	1.00
R0281:Trp63	UTSW	16	25764302	splice site	probably benign
R1448:Trp63	UTSW	16	25889120	missense	possibly damaging	0.67
R1517:Trp63	UTSW	16	25889253	missense	probably damaging	1.00
R1539:Trp63	UTSW	16	25884849	missense	probably benign	0.02
R3922:Trp63	UTSW	16	25889009	missense	probably damaging	1.00
R3977:Trp63	UTSW	16	25820740	intron	probably benign
R3978:Trp63	UTSW	16	25820740	intron	probably benign
R3979:Trp63	UTSW	16	25820740	intron	probably benign
R4689:Trp63	UTSW	16	25865262	missense	possibly damaging	0.90
R4870:Trp63	UTSW	16	25866218	makesense	probably null
R5009:Trp63	UTSW	16	25868227	missense	probably damaging	0.99
R5033:Trp63	UTSW	16	25763306	missense	probably damaging	0.99
R5058:Trp63	UTSW	16	25882594	missense	probably damaging	1.00
R5118:Trp63	UTSW	16	25889010	missense	unknown
R5354:Trp63	UTSW	16	25684355	splice site	probably null
R5363:Trp63	UTSW	16	25863718	missense	probably damaging	0.99
R5668:Trp63	UTSW	16	25866185	missense	possibly damaging	0.52
R6004:Trp63	UTSW	16	25763396	critical splice donor site	probably null
R6029:Trp63	UTSW	16	25868214	missense	probably damaging	1.00
R6170:Trp63	UTSW	16	25884853	missense	probably benign	0.28
R6186:Trp63	UTSW	16	25876733	intron	probably benign
R6266:Trp63	UTSW	16	25862460	missense	probably damaging	0.99
R6466:Trp63	UTSW	16	25763358	missense	probably damaging	1.00
R6486:Trp63	UTSW	16	25865340	missense	probably damaging	0.99
R6913:Trp63	UTSW	16	25889168	missense	probably damaging	1.00
R6980:Trp63	UTSW	16	25802093	missense	probably benign
R7097:Trp63	UTSW	16	25820477	missense	probably damaging	1.00
R7122:Trp63	UTSW	16	25820477	missense	probably damaging	1.00
R7544:Trp63	UTSW	16	25802087	missense	probably benign
R7690:Trp63	UTSW	16	25876733	missense	unknown
R7743:Trp63	UTSW	16	25882625	missense	probably benign	0.05
R7766:Trp63	UTSW	16	25868219	missense	probably damaging	0.97
R7792:Trp63	UTSW	16	25868224	missense	possibly damaging	0.94
R7816:Trp63	UTSW	16	25889240	missense	probably damaging	1.00
R7978:Trp63	UTSW	16	25820686	missense	unknown
R8857:Trp63	UTSW	16	25820476	missense	probably damaging	1.00
R9041:Trp63	UTSW	16	25763333	missense	probably benign
R9123:Trp63	UTSW	16	25820497	missense	probably damaging	1.00
R9491:Trp63	UTSW	16	25876722	missense	unknown
R9642:Trp63	UTSW	16	25863758	missense	probably benign	0.35
Z1088:Trp63	UTSW	16	25763313	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ATAAATGGCTTTTCCGATTCCC -3'
(R):5'- CTCTCACTAGTGGATGTGTGC -3'

Sequencing Primer
(F):5'- CTCCATCTGCACTATGATCATGAAGG -3'
(R):5'- CCTTTGAGCAGCTGGGTCTC -3'

Posted On

2020-09-02