Mutagenetix > Incidental Mutation

Incidental Mutation 'R8324:Slc15a2'

644021

Institutional Source

Beutler Lab

Gene Symbol

Slc15a2

Ensembl Gene

ENSMUSG00000022899

Gene Name

solute carrier family 15 (H+/peptide transporter), member 2

Synonyms

8430408C16Rik, Pept2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R8324 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

36750177-36784962 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 36759307 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 359 (N359T)

Ref Sequence

ENSEMBL: ENSMUSP00000023616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023616] [ENSMUST00000165380] [ENSMUST00000165531]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000023616
AA Change: N359T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023616
Gene: ENSMUSG00000022899
AA Change: N359T

Domain	Start	End	E-Value	Type
low complexity region	35	47	N/A	INTRINSIC
Pfam:PTR2	122	500	1.7e-122	PFAM
Pfam:PTR2	593	686	2.5e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165380

SMART Domains

Protein: ENSMUSP00000131395
Gene: ENSMUSG00000022899

Domain	Start	End	E-Value	Type
low complexity region	35	47	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165531
AA Change: N328T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132663
Gene: ENSMUSG00000022899
AA Change: N328T

Domain	Start	End	E-Value	Type
low complexity region	35	47	N/A	INTRINSIC
Pfam:PTR2	99	469	2.4e-105	PFAM
PDB:2XUT\|C	583	642	3e-10	PDB
transmembrane domain	655	677	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian kidney expresses a proton-coupled peptide transporter that is responsible for the absorption of small peptides, as well as beta-lactam antibiotics and other peptide-like drugs, from the tubular filtrate. This transporter, SLC15A2, belongs to the same gene family as SLC15A1 (MIM 600544), the proton-coupled peptide transporter found in the small intestine (Liu et al, 1995 [PubMed 7756356]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Homozygous mutant mice have impairments of dipeptide transportion, however, show no gross defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,290,395	S753P	probably damaging	Het
Acan	A	G	7: 79,091,056	E390G	probably damaging	Het
Antxr2	T	C	5: 97,938,509	N413S	probably damaging	Het
Bace2	C	T	16: 97,356,908	A36V	possibly damaging	Het
Caprin1	G	A	2: 103,783,181	R79*	probably null	Het
Cdan1	A	G	2: 120,727,325	V507A	probably benign	Het
Cdkl3	T	A	11: 52,022,879		probably null	Het
Chst5	A	T	8: 111,890,508	L160Q	probably benign	Het
Col11a1	C	G	3: 114,164,410	P1111R	probably damaging	Het
Col6a6	T	A	9: 105,755,654	E1470D	probably benign	Het
Cpped1	T	A	16: 11,805,476	T274S	probably benign	Het
Ctnnbl1	G	A	2: 157,779,815	E75K	probably damaging	Het
Cyp4f40	T	C	17: 32,659,528	S15P	probably benign	Het
Ddx46	T	C	13: 55,663,914	S643P	probably damaging	Het
Defb34	A	G	8: 19,123,798	Q16R	probably null	Het
Dhrs2	T	A	14: 55,238,764	V147E	probably damaging	Het
Dnah5	G	T	15: 28,346,865	R2498L	probably damaging	Het
Dpp10	T	A	1: 123,854,172	I93F	probably benign	Het
Eef1e1	T	A	13: 38,655,069	D104V	probably damaging	Het
Egfr	A	G	11: 16,858,971	Y55C	probably damaging	Het
Egfr	A	C	11: 16,908,885	I955L	probably damaging	Het
Ehbp1l1	C	A	19: 5,719,998	V426F	possibly damaging	Het
Fam234a	C	T	17: 26,218,698	V108I	probably benign	Het
Fzd8	T	A	18: 9,214,688	M590K	probably damaging	Het
Gm13287	T	C	4: 88,803,638	S129P	probably damaging	Het
Heatr5b	A	G	17: 78,755,364	S1919P	possibly damaging	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Ikbkap	C	T	4: 56,772,491	E877K	probably damaging	Het
Itpr2	T	C	6: 146,328,398	E1233G	probably damaging	Het
Kcnmb4	A	G	10: 116,418,314	L186P	probably damaging	Het
Krt72	T	A	15: 101,782,145	Y224F	probably damaging	Het
Loxhd1	T	C	18: 77,339,579		probably null	Het
Lrguk	A	G	6: 34,102,571	T914A	probably benign	Het
Lrrtm4	A	G	6: 80,021,991	T129A	probably damaging	Het
Mmp13	A	T	9: 7,276,636	I244F	possibly damaging	Het
Mob1a	T	A	6: 83,329,974	L41Q	probably damaging	Het
Mtcl1	T	C	17: 66,436,217	R426G	probably damaging	Het
Mybbp1a	T	C	11: 72,445,288		probably null	Het
Myh9	A	G	15: 77,788,917		probably null	Het
Myo1d	T	A	11: 80,557,521	D926V	probably damaging	Het
Ncapg	T	G	5: 45,695,668	H825Q	probably damaging	Het
Olfml1	T	C	7: 107,590,363	S212P	probably benign	Het
Olfr656	G	A	7: 104,618,114	R145H	probably benign	Het
Pak2	T	C	16: 32,052,211	N51S	probably benign	Het
Papln	T	C	12: 83,786,619	Y1132H	probably damaging	Het
Pax3	T	A	1: 78,193,789	R134S	probably damaging	Het
Pdzrn4	A	G	15: 92,770,937	E990G	probably damaging	Het
Peak1	A	T	9: 56,207,476	W1394R	probably damaging	Het
Pkn2	T	C	3: 142,829,010	N285D	probably benign	Het
Pramef12	A	C	4: 144,395,857	L39R	probably damaging	Het
Prrc2a	A	G	17: 35,156,984	S897P	possibly damaging	Het
Rad51	A	G	2: 119,123,831	T131A	possibly damaging	Het
Rc3h2	T	A	2: 37,400,726	T255S	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rictor	T	A	15: 6,745,562	V125E	probably damaging	Het
Rps6ka5	C	T	12: 100,558,487	D664N	possibly damaging	Het
Rreb1	T	A	13: 37,947,621	W1584R	probably damaging	Het
Rxra	T	C	2: 27,741,183	I142T	probably damaging	Het
Sall2	T	C	14: 52,312,886	T951A	probably benign	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Slc6a13	T	C	6: 121,337,414	*603Q	probably null	Het
Sptb	T	C	12: 76,619,162	D894G	possibly damaging	Het
Srgn	A	G	10: 62,507,665	L17P	probably damaging	Het
Tmprss9	T	C	10: 80,897,371		probably null	Het
Trav9n-4	T	C	14: 53,294,946	F86L	probably benign	Het
Trp63	A	G	16: 25,876,734	Y482C	unknown	Het
Ttc9b	G	T	7: 27,653,969	A15S	probably damaging	Het
Urb1	A	T	16: 90,791,190	I410N	probably damaging	Het
Vmn2r82	A	T	10: 79,378,893	K237*	probably null	Het
Wwox	G	A	8: 114,489,005		probably null	Het

Other mutations in Slc15a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00505:Slc15a2	APN	16	36753775	missense	probably benign	0.00
IGL00703:Slc15a2	APN	16	36757791	missense	probably benign	0.00
IGL00937:Slc15a2	APN	16	36751880	nonsense	probably null
IGL01511:Slc15a2	APN	16	36784726	missense	probably damaging	0.99
IGL01739:Slc15a2	APN	16	36756230	missense	probably benign
IGL02069:Slc15a2	APN	16	36759251	missense	probably benign	0.02
IGL02076:Slc15a2	APN	16	36762381	missense	probably damaging	1.00
IGL02254:Slc15a2	APN	16	36760087	missense	possibly damaging	0.93
IGL02387:Slc15a2	APN	16	36751775	splice site	probably null
IGL02507:Slc15a2	APN	16	36781659	missense	possibly damaging	0.87
IGL02829:Slc15a2	APN	16	36757193	missense	possibly damaging	0.92
IGL03114:Slc15a2	APN	16	36751905	missense	probably damaging	1.00
IGL03227:Slc15a2	APN	16	36756048	critical splice donor site	probably null
PIT4581001:Slc15a2	UTSW	16	36772043	missense	probably benign
R0058:Slc15a2	UTSW	16	36754547	missense	probably benign	0.08
R0058:Slc15a2	UTSW	16	36754547	missense	probably benign	0.08
R0083:Slc15a2	UTSW	16	36782283	missense	probably damaging	1.00
R0099:Slc15a2	UTSW	16	36753036	missense	probably damaging	1.00
R0104:Slc15a2	UTSW	16	36774635	missense	possibly damaging	0.79
R0402:Slc15a2	UTSW	16	36775598	missense	probably benign	0.00
R0619:Slc15a2	UTSW	16	36759307	missense	probably damaging	1.00
R0963:Slc15a2	UTSW	16	36774573	missense	probably damaging	1.00
R0972:Slc15a2	UTSW	16	36757139	missense	probably benign	0.00
R1440:Slc15a2	UTSW	16	36784643	splice site	probably benign
R1471:Slc15a2	UTSW	16	36753791	missense	probably damaging	0.99
R1569:Slc15a2	UTSW	16	36756383	missense	probably benign	0.00
R1616:Slc15a2	UTSW	16	36754481	missense	probably benign
R2246:Slc15a2	UTSW	16	36762361	missense	probably damaging	1.00
R2405:Slc15a2	UTSW	16	36751837	nonsense	probably null
R3834:Slc15a2	UTSW	16	36772128	nonsense	probably null
R3835:Slc15a2	UTSW	16	36772128	nonsense	probably null
R3885:Slc15a2	UTSW	16	36782304	missense	probably damaging	1.00
R3887:Slc15a2	UTSW	16	36782304	missense	probably damaging	1.00
R3888:Slc15a2	UTSW	16	36782304	missense	probably damaging	1.00
R3889:Slc15a2	UTSW	16	36782304	missense	probably damaging	1.00
R4105:Slc15a2	UTSW	16	36782393	intron	probably benign
R4108:Slc15a2	UTSW	16	36782393	intron	probably benign
R4254:Slc15a2	UTSW	16	36754490	missense	probably benign	0.04
R4352:Slc15a2	UTSW	16	36772028	missense	probably benign	0.08
R4684:Slc15a2	UTSW	16	36757849	missense	probably damaging	1.00
R4747:Slc15a2	UTSW	16	36772136	missense	probably damaging	0.98
R4774:Slc15a2	UTSW	16	36781695	nonsense	probably null
R5151:Slc15a2	UTSW	16	36752297	missense	probably damaging	1.00
R5503:Slc15a2	UTSW	16	36762385	missense	probably damaging	1.00
R5649:Slc15a2	UTSW	16	36772110	nonsense	probably null
R6003:Slc15a2	UTSW	16	36754548	missense	probably benign	0.00
R6261:Slc15a2	UTSW	16	36761611	missense	probably benign	0.25
R6329:Slc15a2	UTSW	16	36751782	missense	possibly damaging	0.94
R6409:Slc15a2	UTSW	16	36761870	missense	probably benign	0.00
R6523:Slc15a2	UTSW	16	36752321	missense	probably benign	0.17
R7125:Slc15a2	UTSW	16	36782298	missense	probably damaging	1.00
R7208:Slc15a2	UTSW	16	36756281	missense	probably benign	0.02
R7234:Slc15a2	UTSW	16	36757811	missense	probably benign	0.05
R7374:Slc15a2	UTSW	16	36751845	missense	probably benign	0.01
R7545:Slc15a2	UTSW	16	36775602	missense	probably damaging	1.00
R7559:Slc15a2	UTSW	16	36751897	missense	probably benign
R7611:Slc15a2	UTSW	16	36756311	missense	probably benign	0.18
R7787:Slc15a2	UTSW	16	36751866	missense	probably benign	0.02
R7825:Slc15a2	UTSW	16	36753034	missense	possibly damaging	0.94
R9035:Slc15a2	UTSW	16	36782357	missense	possibly damaging	0.82
R9037:Slc15a2	UTSW	16	36762363	missense	probably benign	0.11
R9212:Slc15a2	UTSW	16	36781691	nonsense	probably null
R9273:Slc15a2	UTSW	16	36753728	missense	probably benign	0.01
R9363:Slc15a2	UTSW	16	36752310	missense	possibly damaging	0.91
R9368:Slc15a2	UTSW	16	36753718	missense	probably benign	0.00
R9488:Slc15a2	UTSW	16	36759289	missense	probably benign	0.02
T0722:Slc15a2	UTSW	16	36772445	missense	probably benign
V8831:Slc15a2	UTSW	16	36772445	missense	probably benign
X0066:Slc15a2	UTSW	16	36753789	nonsense	probably null
Z1088:Slc15a2	UTSW	16	36772445	missense	probably benign
Z1176:Slc15a2	UTSW	16	36759316	critical splice acceptor site	probably null
Z1176:Slc15a2	UTSW	16	36772445	missense	probably benign
Z1177:Slc15a2	UTSW	16	36772445	missense	probably benign
Z1177:Slc15a2	UTSW	16	36784687	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AAACATCCCAGCTCTGAGTTG -3'
(R):5'- AAAACAGGCTCAGGAAGACTATTTCC -3'

Sequencing Primer
(F):5'- AGCTCTGAGTTGTCGCCAAG -3'
(R):5'- TGTTTTACAAGGGAAGTAGAGCC -3'

Posted On

2020-09-02