Incidental Mutation 'R8324:Slc15a2'
ID 644021
Institutional Source Beutler Lab
Gene Symbol Slc15a2
Ensembl Gene ENSMUSG00000022899
Gene Name solute carrier family 15 (H+/peptide transporter), member 2
Synonyms 8430408C16Rik, Pept2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 36750177-36784962 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 36759307 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 359 (N359T)
Ref Sequence ENSEMBL: ENSMUSP00000023616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023616] [ENSMUST00000165380] [ENSMUST00000165531]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023616
AA Change: N359T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023616
Gene: ENSMUSG00000022899
AA Change: N359T

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 122 500 1.7e-122 PFAM
Pfam:PTR2 593 686 2.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165380
SMART Domains Protein: ENSMUSP00000131395
Gene: ENSMUSG00000022899

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165531
AA Change: N328T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132663
Gene: ENSMUSG00000022899
AA Change: N328T

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 99 469 2.4e-105 PFAM
PDB:2XUT|C 583 642 3e-10 PDB
transmembrane domain 655 677 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian kidney expresses a proton-coupled peptide transporter that is responsible for the absorption of small peptides, as well as beta-lactam antibiotics and other peptide-like drugs, from the tubular filtrate. This transporter, SLC15A2, belongs to the same gene family as SLC15A1 (MIM 600544), the proton-coupled peptide transporter found in the small intestine (Liu et al, 1995 [PubMed 7756356]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Homozygous mutant mice have impairments of dipeptide transportion, however, show no gross defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,290,395 S753P probably damaging Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Antxr2 T C 5: 97,938,509 N413S probably damaging Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
Caprin1 G A 2: 103,783,181 R79* probably null Het
Cdan1 A G 2: 120,727,325 V507A probably benign Het
Cdkl3 T A 11: 52,022,879 probably null Het
Chst5 A T 8: 111,890,508 L160Q probably benign Het
Col11a1 C G 3: 114,164,410 P1111R probably damaging Het
Col6a6 T A 9: 105,755,654 E1470D probably benign Het
Cpped1 T A 16: 11,805,476 T274S probably benign Het
Ctnnbl1 G A 2: 157,779,815 E75K probably damaging Het
Cyp4f40 T C 17: 32,659,528 S15P probably benign Het
Ddx46 T C 13: 55,663,914 S643P probably damaging Het
Defb34 A G 8: 19,123,798 Q16R probably null Het
Dhrs2 T A 14: 55,238,764 V147E probably damaging Het
Dnah5 G T 15: 28,346,865 R2498L probably damaging Het
Dpp10 T A 1: 123,854,172 I93F probably benign Het
Eef1e1 T A 13: 38,655,069 D104V probably damaging Het
Egfr A G 11: 16,858,971 Y55C probably damaging Het
Egfr A C 11: 16,908,885 I955L probably damaging Het
Ehbp1l1 C A 19: 5,719,998 V426F possibly damaging Het
Fam234a C T 17: 26,218,698 V108I probably benign Het
Fzd8 T A 18: 9,214,688 M590K probably damaging Het
Gm13287 T C 4: 88,803,638 S129P probably damaging Het
Heatr5b A G 17: 78,755,364 S1919P possibly damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ikbkap C T 4: 56,772,491 E877K probably damaging Het
Itpr2 T C 6: 146,328,398 E1233G probably damaging Het
Kcnmb4 A G 10: 116,418,314 L186P probably damaging Het
Krt72 T A 15: 101,782,145 Y224F probably damaging Het
Loxhd1 T C 18: 77,339,579 probably null Het
Lrguk A G 6: 34,102,571 T914A probably benign Het
Lrrtm4 A G 6: 80,021,991 T129A probably damaging Het
Mmp13 A T 9: 7,276,636 I244F possibly damaging Het
Mob1a T A 6: 83,329,974 L41Q probably damaging Het
Mtcl1 T C 17: 66,436,217 R426G probably damaging Het
Mybbp1a T C 11: 72,445,288 probably null Het
Myh9 A G 15: 77,788,917 probably null Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Ncapg T G 5: 45,695,668 H825Q probably damaging Het
Olfml1 T C 7: 107,590,363 S212P probably benign Het
Olfr656 G A 7: 104,618,114 R145H probably benign Het
Pak2 T C 16: 32,052,211 N51S probably benign Het
Papln T C 12: 83,786,619 Y1132H probably damaging Het
Pax3 T A 1: 78,193,789 R134S probably damaging Het
Pdzrn4 A G 15: 92,770,937 E990G probably damaging Het
Peak1 A T 9: 56,207,476 W1394R probably damaging Het
Pkn2 T C 3: 142,829,010 N285D probably benign Het
Pramef12 A C 4: 144,395,857 L39R probably damaging Het
Prrc2a A G 17: 35,156,984 S897P possibly damaging Het
Rad51 A G 2: 119,123,831 T131A possibly damaging Het
Rc3h2 T A 2: 37,400,726 T255S possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rictor T A 15: 6,745,562 V125E probably damaging Het
Rps6ka5 C T 12: 100,558,487 D664N possibly damaging Het
Rreb1 T A 13: 37,947,621 W1584R probably damaging Het
Rxra T C 2: 27,741,183 I142T probably damaging Het
Sall2 T C 14: 52,312,886 T951A probably benign Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc6a13 T C 6: 121,337,414 *603Q probably null Het
Sptb T C 12: 76,619,162 D894G possibly damaging Het
Srgn A G 10: 62,507,665 L17P probably damaging Het
Tmprss9 T C 10: 80,897,371 probably null Het
Trav9n-4 T C 14: 53,294,946 F86L probably benign Het
Trp63 A G 16: 25,876,734 Y482C unknown Het
Ttc9b G T 7: 27,653,969 A15S probably damaging Het
Urb1 A T 16: 90,791,190 I410N probably damaging Het
Vmn2r82 A T 10: 79,378,893 K237* probably null Het
Wwox G A 8: 114,489,005 probably null Het
Other mutations in Slc15a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Slc15a2 APN 16 36753775 missense probably benign 0.00
IGL00703:Slc15a2 APN 16 36757791 missense probably benign 0.00
IGL00937:Slc15a2 APN 16 36751880 nonsense probably null
IGL01511:Slc15a2 APN 16 36784726 missense probably damaging 0.99
IGL01739:Slc15a2 APN 16 36756230 missense probably benign
IGL02069:Slc15a2 APN 16 36759251 missense probably benign 0.02
IGL02076:Slc15a2 APN 16 36762381 missense probably damaging 1.00
IGL02254:Slc15a2 APN 16 36760087 missense possibly damaging 0.93
IGL02387:Slc15a2 APN 16 36751775 splice site probably null
IGL02507:Slc15a2 APN 16 36781659 missense possibly damaging 0.87
IGL02829:Slc15a2 APN 16 36757193 missense possibly damaging 0.92
IGL03114:Slc15a2 APN 16 36751905 missense probably damaging 1.00
IGL03227:Slc15a2 APN 16 36756048 critical splice donor site probably null
PIT4581001:Slc15a2 UTSW 16 36772043 missense probably benign
R0058:Slc15a2 UTSW 16 36754547 missense probably benign 0.08
R0058:Slc15a2 UTSW 16 36754547 missense probably benign 0.08
R0083:Slc15a2 UTSW 16 36782283 missense probably damaging 1.00
R0099:Slc15a2 UTSW 16 36753036 missense probably damaging 1.00
R0104:Slc15a2 UTSW 16 36774635 missense possibly damaging 0.79
R0402:Slc15a2 UTSW 16 36775598 missense probably benign 0.00
R0619:Slc15a2 UTSW 16 36759307 missense probably damaging 1.00
R0963:Slc15a2 UTSW 16 36774573 missense probably damaging 1.00
R0972:Slc15a2 UTSW 16 36757139 missense probably benign 0.00
R1440:Slc15a2 UTSW 16 36784643 splice site probably benign
R1471:Slc15a2 UTSW 16 36753791 missense probably damaging 0.99
R1569:Slc15a2 UTSW 16 36756383 missense probably benign 0.00
R1616:Slc15a2 UTSW 16 36754481 missense probably benign
R2246:Slc15a2 UTSW 16 36762361 missense probably damaging 1.00
R2405:Slc15a2 UTSW 16 36751837 nonsense probably null
R3834:Slc15a2 UTSW 16 36772128 nonsense probably null
R3835:Slc15a2 UTSW 16 36772128 nonsense probably null
R3885:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R3887:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R3888:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R3889:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R4105:Slc15a2 UTSW 16 36782393 intron probably benign
R4108:Slc15a2 UTSW 16 36782393 intron probably benign
R4254:Slc15a2 UTSW 16 36754490 missense probably benign 0.04
R4352:Slc15a2 UTSW 16 36772028 missense probably benign 0.08
R4684:Slc15a2 UTSW 16 36757849 missense probably damaging 1.00
R4747:Slc15a2 UTSW 16 36772136 missense probably damaging 0.98
R4774:Slc15a2 UTSW 16 36781695 nonsense probably null
R5151:Slc15a2 UTSW 16 36752297 missense probably damaging 1.00
R5503:Slc15a2 UTSW 16 36762385 missense probably damaging 1.00
R5649:Slc15a2 UTSW 16 36772110 nonsense probably null
R6003:Slc15a2 UTSW 16 36754548 missense probably benign 0.00
R6261:Slc15a2 UTSW 16 36761611 missense probably benign 0.25
R6329:Slc15a2 UTSW 16 36751782 missense possibly damaging 0.94
R6409:Slc15a2 UTSW 16 36761870 missense probably benign 0.00
R6523:Slc15a2 UTSW 16 36752321 missense probably benign 0.17
R7125:Slc15a2 UTSW 16 36782298 missense probably damaging 1.00
R7208:Slc15a2 UTSW 16 36756281 missense probably benign 0.02
R7234:Slc15a2 UTSW 16 36757811 missense probably benign 0.05
R7374:Slc15a2 UTSW 16 36751845 missense probably benign 0.01
R7545:Slc15a2 UTSW 16 36775602 missense probably damaging 1.00
R7559:Slc15a2 UTSW 16 36751897 missense probably benign
R7611:Slc15a2 UTSW 16 36756311 missense probably benign 0.18
R7787:Slc15a2 UTSW 16 36751866 missense probably benign 0.02
R7825:Slc15a2 UTSW 16 36753034 missense possibly damaging 0.94
R9035:Slc15a2 UTSW 16 36782357 missense possibly damaging 0.82
R9037:Slc15a2 UTSW 16 36762363 missense probably benign 0.11
R9212:Slc15a2 UTSW 16 36781691 nonsense probably null
R9273:Slc15a2 UTSW 16 36753728 missense probably benign 0.01
R9363:Slc15a2 UTSW 16 36752310 missense possibly damaging 0.91
R9368:Slc15a2 UTSW 16 36753718 missense probably benign 0.00
R9488:Slc15a2 UTSW 16 36759289 missense probably benign 0.02
T0722:Slc15a2 UTSW 16 36772445 missense probably benign
V8831:Slc15a2 UTSW 16 36772445 missense probably benign
X0066:Slc15a2 UTSW 16 36753789 nonsense probably null
Z1088:Slc15a2 UTSW 16 36772445 missense probably benign
Z1176:Slc15a2 UTSW 16 36759316 critical splice acceptor site probably null
Z1176:Slc15a2 UTSW 16 36772445 missense probably benign
Z1177:Slc15a2 UTSW 16 36772445 missense probably benign
Z1177:Slc15a2 UTSW 16 36784687 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAACATCCCAGCTCTGAGTTG -3'
(R):5'- AAAACAGGCTCAGGAAGACTATTTCC -3'

Sequencing Primer
(F):5'- AGCTCTGAGTTGTCGCCAAG -3'
(R):5'- TGTTTTACAAGGGAAGTAGAGCC -3'
Posted On 2020-09-02