Incidental Mutation 'R8324:Slc15a2'
ID 644021
Institutional Source Beutler Lab
Gene Symbol Slc15a2
Ensembl Gene ENSMUSG00000022899
Gene Name solute carrier family 15 (H+/peptide transporter), member 2
Synonyms Pept2, 8430408C16Rik
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 36570539-36605324 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 36579669 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 359 (N359T)
Ref Sequence ENSEMBL: ENSMUSP00000023616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023616] [ENSMUST00000165380] [ENSMUST00000165531]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023616
AA Change: N359T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023616
Gene: ENSMUSG00000022899
AA Change: N359T

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 122 500 1.7e-122 PFAM
Pfam:PTR2 593 686 2.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165380
SMART Domains Protein: ENSMUSP00000131395
Gene: ENSMUSG00000022899

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165531
AA Change: N328T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132663
Gene: ENSMUSG00000022899
AA Change: N328T

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 99 469 2.4e-105 PFAM
PDB:2XUT|C 583 642 3e-10 PDB
transmembrane domain 655 677 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian kidney expresses a proton-coupled peptide transporter that is responsible for the absorption of small peptides, as well as beta-lactam antibiotics and other peptide-like drugs, from the tubular filtrate. This transporter, SLC15A2, belongs to the same gene family as SLC15A1 (MIM 600544), the proton-coupled peptide transporter found in the small intestine (Liu et al, 1995 [PubMed 7756356]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Homozygous mutant mice have impairments of dipeptide transportion, however, show no gross defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Slc15a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Slc15a2 APN 16 36,574,137 (GRCm39) missense probably benign 0.00
IGL00703:Slc15a2 APN 16 36,578,153 (GRCm39) missense probably benign 0.00
IGL00937:Slc15a2 APN 16 36,572,242 (GRCm39) nonsense probably null
IGL01511:Slc15a2 APN 16 36,605,088 (GRCm39) missense probably damaging 0.99
IGL01739:Slc15a2 APN 16 36,576,592 (GRCm39) missense probably benign
IGL02069:Slc15a2 APN 16 36,579,613 (GRCm39) missense probably benign 0.02
IGL02076:Slc15a2 APN 16 36,582,743 (GRCm39) missense probably damaging 1.00
IGL02254:Slc15a2 APN 16 36,580,449 (GRCm39) missense possibly damaging 0.93
IGL02387:Slc15a2 APN 16 36,572,137 (GRCm39) splice site probably null
IGL02507:Slc15a2 APN 16 36,602,021 (GRCm39) missense possibly damaging 0.87
IGL02829:Slc15a2 APN 16 36,577,555 (GRCm39) missense possibly damaging 0.92
IGL03114:Slc15a2 APN 16 36,572,267 (GRCm39) missense probably damaging 1.00
IGL03227:Slc15a2 APN 16 36,576,410 (GRCm39) critical splice donor site probably null
PIT4581001:Slc15a2 UTSW 16 36,592,405 (GRCm39) missense probably benign
R0058:Slc15a2 UTSW 16 36,574,909 (GRCm39) missense probably benign 0.08
R0058:Slc15a2 UTSW 16 36,574,909 (GRCm39) missense probably benign 0.08
R0083:Slc15a2 UTSW 16 36,602,645 (GRCm39) missense probably damaging 1.00
R0099:Slc15a2 UTSW 16 36,573,398 (GRCm39) missense probably damaging 1.00
R0104:Slc15a2 UTSW 16 36,594,997 (GRCm39) missense possibly damaging 0.79
R0402:Slc15a2 UTSW 16 36,595,960 (GRCm39) missense probably benign 0.00
R0619:Slc15a2 UTSW 16 36,579,669 (GRCm39) missense probably damaging 1.00
R0963:Slc15a2 UTSW 16 36,594,935 (GRCm39) missense probably damaging 1.00
R0972:Slc15a2 UTSW 16 36,577,501 (GRCm39) missense probably benign 0.00
R1440:Slc15a2 UTSW 16 36,605,005 (GRCm39) splice site probably benign
R1471:Slc15a2 UTSW 16 36,574,153 (GRCm39) missense probably damaging 0.99
R1569:Slc15a2 UTSW 16 36,576,745 (GRCm39) missense probably benign 0.00
R1616:Slc15a2 UTSW 16 36,574,843 (GRCm39) missense probably benign
R2246:Slc15a2 UTSW 16 36,582,723 (GRCm39) missense probably damaging 1.00
R2405:Slc15a2 UTSW 16 36,572,199 (GRCm39) nonsense probably null
R3834:Slc15a2 UTSW 16 36,592,490 (GRCm39) nonsense probably null
R3835:Slc15a2 UTSW 16 36,592,490 (GRCm39) nonsense probably null
R3885:Slc15a2 UTSW 16 36,602,666 (GRCm39) missense probably damaging 1.00
R3887:Slc15a2 UTSW 16 36,602,666 (GRCm39) missense probably damaging 1.00
R3888:Slc15a2 UTSW 16 36,602,666 (GRCm39) missense probably damaging 1.00
R3889:Slc15a2 UTSW 16 36,602,666 (GRCm39) missense probably damaging 1.00
R4105:Slc15a2 UTSW 16 36,602,755 (GRCm39) intron probably benign
R4108:Slc15a2 UTSW 16 36,602,755 (GRCm39) intron probably benign
R4254:Slc15a2 UTSW 16 36,574,852 (GRCm39) missense probably benign 0.04
R4352:Slc15a2 UTSW 16 36,592,390 (GRCm39) missense probably benign 0.08
R4684:Slc15a2 UTSW 16 36,578,211 (GRCm39) missense probably damaging 1.00
R4747:Slc15a2 UTSW 16 36,592,498 (GRCm39) missense probably damaging 0.98
R4774:Slc15a2 UTSW 16 36,602,057 (GRCm39) nonsense probably null
R5151:Slc15a2 UTSW 16 36,572,659 (GRCm39) missense probably damaging 1.00
R5503:Slc15a2 UTSW 16 36,582,747 (GRCm39) missense probably damaging 1.00
R5649:Slc15a2 UTSW 16 36,592,472 (GRCm39) nonsense probably null
R6003:Slc15a2 UTSW 16 36,574,910 (GRCm39) missense probably benign 0.00
R6261:Slc15a2 UTSW 16 36,581,973 (GRCm39) missense probably benign 0.25
R6329:Slc15a2 UTSW 16 36,572,144 (GRCm39) missense possibly damaging 0.94
R6409:Slc15a2 UTSW 16 36,582,232 (GRCm39) missense probably benign 0.00
R6523:Slc15a2 UTSW 16 36,572,683 (GRCm39) missense probably benign 0.17
R7125:Slc15a2 UTSW 16 36,602,660 (GRCm39) missense probably damaging 1.00
R7208:Slc15a2 UTSW 16 36,576,643 (GRCm39) missense probably benign 0.02
R7234:Slc15a2 UTSW 16 36,578,173 (GRCm39) missense probably benign 0.05
R7374:Slc15a2 UTSW 16 36,572,207 (GRCm39) missense probably benign 0.01
R7545:Slc15a2 UTSW 16 36,595,964 (GRCm39) missense probably damaging 1.00
R7559:Slc15a2 UTSW 16 36,572,259 (GRCm39) missense probably benign
R7611:Slc15a2 UTSW 16 36,576,673 (GRCm39) missense probably benign 0.18
R7787:Slc15a2 UTSW 16 36,572,228 (GRCm39) missense probably benign 0.02
R7825:Slc15a2 UTSW 16 36,573,396 (GRCm39) missense possibly damaging 0.94
R9035:Slc15a2 UTSW 16 36,602,719 (GRCm39) missense possibly damaging 0.82
R9037:Slc15a2 UTSW 16 36,582,725 (GRCm39) missense probably benign 0.11
R9212:Slc15a2 UTSW 16 36,602,053 (GRCm39) nonsense probably null
R9273:Slc15a2 UTSW 16 36,574,090 (GRCm39) missense probably benign 0.01
R9363:Slc15a2 UTSW 16 36,572,672 (GRCm39) missense possibly damaging 0.91
R9368:Slc15a2 UTSW 16 36,574,080 (GRCm39) missense probably benign 0.00
R9488:Slc15a2 UTSW 16 36,579,651 (GRCm39) missense probably benign 0.02
T0722:Slc15a2 UTSW 16 36,772,445 (GRCm38) missense probably benign
V8831:Slc15a2 UTSW 16 36,772,445 (GRCm38) missense probably benign
X0066:Slc15a2 UTSW 16 36,574,151 (GRCm39) nonsense probably null
Z1088:Slc15a2 UTSW 16 36,772,445 (GRCm38) missense probably benign
Z1176:Slc15a2 UTSW 16 36,772,445 (GRCm38) missense probably benign
Z1176:Slc15a2 UTSW 16 36,579,678 (GRCm39) critical splice acceptor site probably null
Z1177:Slc15a2 UTSW 16 36,605,049 (GRCm39) frame shift probably null
Z1177:Slc15a2 UTSW 16 36,772,445 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAACATCCCAGCTCTGAGTTG -3'
(R):5'- AAAACAGGCTCAGGAAGACTATTTCC -3'

Sequencing Primer
(F):5'- AGCTCTGAGTTGTCGCCAAG -3'
(R):5'- TGTTTTACAAGGGAAGTAGAGCC -3'
Posted On 2020-09-02