Incidental Mutation 'R8324:Urb1'
ID 644022
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene Name URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms 5730405K23Rik, 4921511H13Rik
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 90548415-90607301 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90588078 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 410 (I410N)
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140920]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000140920
AA Change: I410N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: I410N

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90,550,209 (GRCm39) critical splice donor site probably null
IGL00915:Urb1 APN 16 90,575,986 (GRCm39) missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90,589,702 (GRCm39) missense probably damaging 1.00
IGL01122:Urb1 APN 16 90,601,346 (GRCm39) missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90,554,649 (GRCm39) missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90,574,448 (GRCm39) missense probably benign 0.11
IGL01606:Urb1 APN 16 90,557,347 (GRCm39) missense probably damaging 1.00
IGL01989:Urb1 APN 16 90,566,474 (GRCm39) splice site probably benign
IGL02516:Urb1 APN 16 90,569,583 (GRCm39) missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90,585,044 (GRCm39) missense probably benign 0.02
IGL03165:Urb1 APN 16 90,577,192 (GRCm39) missense probably damaging 1.00
IGL03216:Urb1 APN 16 90,585,002 (GRCm39) missense probably benign 0.00
H8562:Urb1 UTSW 16 90,566,357 (GRCm39) missense probably benign 0.08
H8786:Urb1 UTSW 16 90,566,357 (GRCm39) missense probably benign 0.08
R0064:Urb1 UTSW 16 90,576,028 (GRCm39) missense probably benign
R0064:Urb1 UTSW 16 90,576,028 (GRCm39) missense probably benign
R0359:Urb1 UTSW 16 90,588,048 (GRCm39) missense probably damaging 1.00
R0386:Urb1 UTSW 16 90,593,287 (GRCm39) missense probably damaging 1.00
R0508:Urb1 UTSW 16 90,580,150 (GRCm39) splice site probably benign
R0517:Urb1 UTSW 16 90,574,310 (GRCm39) nonsense probably null
R0704:Urb1 UTSW 16 90,573,095 (GRCm39) missense probably benign 0.31
R0755:Urb1 UTSW 16 90,576,026 (GRCm39) missense probably benign
R0755:Urb1 UTSW 16 90,570,982 (GRCm39) missense probably damaging 1.00
R0783:Urb1 UTSW 16 90,607,185 (GRCm39) missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90,592,336 (GRCm39) missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90,592,336 (GRCm39) missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90,566,335 (GRCm39) missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90,573,206 (GRCm39) splice site probably null
R1344:Urb1 UTSW 16 90,566,354 (GRCm39) missense probably damaging 1.00
R1418:Urb1 UTSW 16 90,566,354 (GRCm39) missense probably damaging 1.00
R1453:Urb1 UTSW 16 90,593,380 (GRCm39) missense probably damaging 1.00
R1470:Urb1 UTSW 16 90,548,902 (GRCm39) missense probably benign 0.34
R1470:Urb1 UTSW 16 90,548,902 (GRCm39) missense probably benign 0.34
R1520:Urb1 UTSW 16 90,571,633 (GRCm39) missense probably benign 0.00
R1521:Urb1 UTSW 16 90,550,751 (GRCm39) missense probably damaging 1.00
R1598:Urb1 UTSW 16 90,574,328 (GRCm39) missense possibly damaging 0.93
R1617:Urb1 UTSW 16 90,557,340 (GRCm39) missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90,570,936 (GRCm39) critical splice donor site probably null
R1640:Urb1 UTSW 16 90,569,514 (GRCm39) missense probably benign 0.00
R1664:Urb1 UTSW 16 90,584,970 (GRCm39) critical splice donor site probably null
R1672:Urb1 UTSW 16 90,584,285 (GRCm39) missense probably damaging 1.00
R1694:Urb1 UTSW 16 90,563,928 (GRCm39) missense probably benign
R1856:Urb1 UTSW 16 90,558,583 (GRCm39) missense probably benign 0.00
R2001:Urb1 UTSW 16 90,559,232 (GRCm39) missense probably benign 0.30
R2196:Urb1 UTSW 16 90,571,144 (GRCm39) missense probably benign 0.01
R2850:Urb1 UTSW 16 90,571,144 (GRCm39) missense probably benign 0.01
R3009:Urb1 UTSW 16 90,571,686 (GRCm39) missense probably benign 0.09
R3104:Urb1 UTSW 16 90,592,331 (GRCm39) missense probably damaging 1.00
R3105:Urb1 UTSW 16 90,592,331 (GRCm39) missense probably damaging 1.00
R3106:Urb1 UTSW 16 90,592,331 (GRCm39) missense probably damaging 1.00
R3160:Urb1 UTSW 16 90,594,791 (GRCm39) missense probably damaging 1.00
R3162:Urb1 UTSW 16 90,594,791 (GRCm39) missense probably damaging 1.00
R3900:Urb1 UTSW 16 90,580,264 (GRCm39) missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90,566,353 (GRCm39) missense probably damaging 1.00
R4036:Urb1 UTSW 16 90,584,974 (GRCm39) missense probably benign
R4332:Urb1 UTSW 16 90,571,425 (GRCm39) missense probably damaging 1.00
R4448:Urb1 UTSW 16 90,566,282 (GRCm39) missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90,585,034 (GRCm39) missense probably benign 0.04
R4593:Urb1 UTSW 16 90,584,332 (GRCm39) missense probably damaging 1.00
R4610:Urb1 UTSW 16 90,573,159 (GRCm39) missense probably benign 0.43
R4659:Urb1 UTSW 16 90,573,017 (GRCm39) missense probably damaging 0.96
R4672:Urb1 UTSW 16 90,569,522 (GRCm39) missense probably benign
R4681:Urb1 UTSW 16 90,601,425 (GRCm39) missense probably damaging 0.99
R4771:Urb1 UTSW 16 90,550,406 (GRCm39) missense probably benign 0.00
R4790:Urb1 UTSW 16 90,566,443 (GRCm39) nonsense probably null
R4798:Urb1 UTSW 16 90,554,715 (GRCm39) missense probably benign 0.12
R4809:Urb1 UTSW 16 90,556,730 (GRCm39) missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90,592,302 (GRCm39) nonsense probably null
R4916:Urb1 UTSW 16 90,580,216 (GRCm39) missense probably damaging 1.00
R4969:Urb1 UTSW 16 90,602,299 (GRCm39) missense probably damaging 1.00
R5032:Urb1 UTSW 16 90,553,059 (GRCm39) missense probably benign 0.00
R5111:Urb1 UTSW 16 90,548,905 (GRCm39) missense probably benign 0.00
R5122:Urb1 UTSW 16 90,548,983 (GRCm39) nonsense probably null
R5184:Urb1 UTSW 16 90,580,162 (GRCm39) critical splice donor site probably null
R5199:Urb1 UTSW 16 90,589,636 (GRCm39) missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90,589,650 (GRCm39) missense probably damaging 1.00
R5767:Urb1 UTSW 16 90,573,051 (GRCm39) missense probably benign 0.00
R5812:Urb1 UTSW 16 90,601,425 (GRCm39) missense probably damaging 0.99
R5872:Urb1 UTSW 16 90,569,652 (GRCm39) nonsense probably null
R6052:Urb1 UTSW 16 90,559,271 (GRCm39) missense probably damaging 1.00
R6063:Urb1 UTSW 16 90,585,985 (GRCm39) missense probably benign 0.02
R6065:Urb1 UTSW 16 90,600,220 (GRCm39) missense probably benign 0.03
R6181:Urb1 UTSW 16 90,575,982 (GRCm39) missense probably benign 0.00
R6268:Urb1 UTSW 16 90,550,807 (GRCm39) missense probably benign 0.03
R6429:Urb1 UTSW 16 90,559,318 (GRCm39) splice site probably null
R6572:Urb1 UTSW 16 90,584,302 (GRCm39) missense probably benign 0.37
R6606:Urb1 UTSW 16 90,607,156 (GRCm39) missense probably benign 0.00
R6730:Urb1 UTSW 16 90,575,971 (GRCm39) missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90,578,994 (GRCm39) missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90,588,054 (GRCm39) missense probably damaging 1.00
R7238:Urb1 UTSW 16 90,549,003 (GRCm39) missense possibly damaging 0.88
R7339:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7341:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7361:Urb1 UTSW 16 90,571,656 (GRCm39) missense probably damaging 0.99
R7365:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7366:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7440:Urb1 UTSW 16 90,584,296 (GRCm39) missense probably damaging 1.00
R7530:Urb1 UTSW 16 90,558,522 (GRCm39) missense probably damaging 1.00
R7553:Urb1 UTSW 16 90,589,752 (GRCm39) missense probably damaging 1.00
R7557:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7603:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7607:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7609:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7610:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7612:Urb1 UTSW 16 90,594,798 (GRCm39) missense probably damaging 1.00
R7613:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7684:Urb1 UTSW 16 90,583,006 (GRCm39) nonsense probably null
R8029:Urb1 UTSW 16 90,576,040 (GRCm39) missense possibly damaging 0.67
R8680:Urb1 UTSW 16 90,571,513 (GRCm39) missense probably benign 0.00
R8785:Urb1 UTSW 16 90,600,311 (GRCm39) missense probably benign 0.07
R8914:Urb1 UTSW 16 90,607,122 (GRCm39) missense probably damaging 1.00
R8959:Urb1 UTSW 16 90,571,005 (GRCm39) missense probably benign 0.26
R9005:Urb1 UTSW 16 90,550,678 (GRCm39) missense probably benign 0.01
R9126:Urb1 UTSW 16 90,566,290 (GRCm39) missense possibly damaging 0.53
R9195:Urb1 UTSW 16 90,589,638 (GRCm39) missense probably benign 0.03
R9276:Urb1 UTSW 16 90,569,463 (GRCm39) splice site probably benign
R9534:Urb1 UTSW 16 90,583,096 (GRCm39) missense possibly damaging 0.54
Z1177:Urb1 UTSW 16 90,571,750 (GRCm39) missense probably benign 0.05
Z1177:Urb1 UTSW 16 90,550,771 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTTTTCAGGAGCCACACG -3'
(R):5'- AATTCTTACGGTGTAGCTTGGTTAC -3'

Sequencing Primer
(F):5'- TCAACACTTGCTGGGAACTG -3'
(R):5'- ACTGTGTGTCTAGTATTCTCATGGAG -3'
Posted On 2020-09-02