Incidental Mutation 'R8324:Prrc2a'
ID 644026
Institutional Source Beutler Lab
Gene Symbol Prrc2a
Ensembl Gene ENSMUSG00000024393
Gene Name proline-rich coiled-coil 2A
Synonyms 3110039B05Rik, D17H6S51E, Wbp12, G2, Bat2, Bat-2
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 35368052-35383873 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35375960 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 897 (S897P)
Ref Sequence ENSEMBL: ENSMUSP00000025253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025253] [ENSMUST00000174805]
AlphaFold Q7TSC1
Predicted Effect possibly damaging
Transcript: ENSMUST00000025253
AA Change: S897P

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025253
Gene: ENSMUSG00000024393
AA Change: S897P

DomainStartEndE-ValueType
Pfam:BAT2_N 1 189 1.2e-70 PFAM
low complexity region 243 276 N/A INTRINSIC
low complexity region 343 357 N/A INTRINSIC
low complexity region 396 413 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
coiled coil region 455 494 N/A INTRINSIC
low complexity region 504 523 N/A INTRINSIC
low complexity region 527 566 N/A INTRINSIC
low complexity region 593 618 N/A INTRINSIC
low complexity region 643 684 N/A INTRINSIC
low complexity region 687 709 N/A INTRINSIC
low complexity region 711 717 N/A INTRINSIC
low complexity region 755 768 N/A INTRINSIC
low complexity region 826 833 N/A INTRINSIC
low complexity region 861 871 N/A INTRINSIC
low complexity region 882 894 N/A INTRINSIC
low complexity region 902 924 N/A INTRINSIC
low complexity region 944 966 N/A INTRINSIC
low complexity region 1032 1070 N/A INTRINSIC
low complexity region 1129 1149 N/A INTRINSIC
low complexity region 1162 1179 N/A INTRINSIC
low complexity region 1190 1211 N/A INTRINSIC
low complexity region 1234 1242 N/A INTRINSIC
low complexity region 1285 1300 N/A INTRINSIC
low complexity region 1346 1360 N/A INTRINSIC
low complexity region 1394 1424 N/A INTRINSIC
low complexity region 1430 1456 N/A INTRINSIC
low complexity region 1488 1511 N/A INTRINSIC
low complexity region 1553 1565 N/A INTRINSIC
low complexity region 1693 1713 N/A INTRINSIC
internal_repeat_1 1810 1860 5.56e-5 PROSPERO
low complexity region 1879 1895 N/A INTRINSIC
internal_repeat_1 1924 1983 5.56e-5 PROSPERO
low complexity region 1995 2017 N/A INTRINSIC
low complexity region 2019 2041 N/A INTRINSIC
low complexity region 2070 2086 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174805
AA Change: S842P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133550
Gene: ENSMUSG00000024393
AA Change: S842P

DomainStartEndE-ValueType
Pfam:BAT2_N 1 137 6.6e-53 PFAM
low complexity region 188 221 N/A INTRINSIC
low complexity region 288 302 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
coiled coil region 400 439 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 472 511 N/A INTRINSIC
low complexity region 538 563 N/A INTRINSIC
low complexity region 588 629 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 656 662 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
low complexity region 771 778 N/A INTRINSIC
low complexity region 806 816 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 847 869 N/A INTRINSIC
low complexity region 889 911 N/A INTRINSIC
low complexity region 977 1015 N/A INTRINSIC
low complexity region 1074 1094 N/A INTRINSIC
low complexity region 1107 1124 N/A INTRINSIC
low complexity region 1135 1156 N/A INTRINSIC
low complexity region 1179 1187 N/A INTRINSIC
low complexity region 1230 1245 N/A INTRINSIC
low complexity region 1291 1305 N/A INTRINSIC
low complexity region 1339 1369 N/A INTRINSIC
low complexity region 1375 1401 N/A INTRINSIC
low complexity region 1433 1456 N/A INTRINSIC
low complexity region 1498 1510 N/A INTRINSIC
low complexity region 1638 1658 N/A INTRINSIC
internal_repeat_1 1755 1804 3.99e-5 PROSPERO
low complexity region 1823 1839 N/A INTRINSIC
internal_repeat_1 1868 1927 3.99e-5 PROSPERO
low complexity region 1939 1961 N/A INTRINSIC
low complexity region 1963 1985 N/A INTRINSIC
low complexity region 2014 2030 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A cluster of genes, BAT1-BAT5, has been localized in the vicinity of the genes for TNF alpha and TNF beta. These genes are all within the human major histocompatibility complex class III region. This gene has microsatellite repeats which are associated with the age-at-onset of insulin-dependent diabetes mellitus (IDDM) and possibly thought to be involved with the inflammatory process of pancreatic beta-cell destruction during the development of IDDM. This gene is also a candidate gene for the development of rheumatoid arthritis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Prrc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Prrc2a APN 17 35,373,959 (GRCm39) missense probably damaging 0.99
IGL01083:Prrc2a APN 17 35,375,177 (GRCm39) missense possibly damaging 0.93
IGL01394:Prrc2a APN 17 35,372,080 (GRCm39) missense probably benign 0.00
IGL01618:Prrc2a APN 17 35,368,529 (GRCm39) missense probably damaging 1.00
IGL01700:Prrc2a APN 17 35,369,643 (GRCm39) missense possibly damaging 0.93
IGL01937:Prrc2a APN 17 35,374,567 (GRCm39) missense possibly damaging 0.63
IGL02407:Prrc2a APN 17 35,379,480 (GRCm39) missense unknown
IGL02683:Prrc2a APN 17 35,374,969 (GRCm39) missense probably benign 0.00
R0145:Prrc2a UTSW 17 35,374,796 (GRCm39) missense probably benign
R0309:Prrc2a UTSW 17 35,369,891 (GRCm39) splice site probably benign
R0441:Prrc2a UTSW 17 35,368,664 (GRCm39) splice site probably benign
R0617:Prrc2a UTSW 17 35,372,536 (GRCm39) missense probably damaging 1.00
R0645:Prrc2a UTSW 17 35,375,308 (GRCm39) missense probably damaging 0.99
R1351:Prrc2a UTSW 17 35,376,863 (GRCm39) missense possibly damaging 0.86
R1432:Prrc2a UTSW 17 35,372,888 (GRCm39) splice site probably benign
R1490:Prrc2a UTSW 17 35,372,230 (GRCm39) missense probably benign
R1643:Prrc2a UTSW 17 35,375,930 (GRCm39) missense probably damaging 0.99
R1734:Prrc2a UTSW 17 35,369,683 (GRCm39) missense possibly damaging 0.93
R1869:Prrc2a UTSW 17 35,372,284 (GRCm39) missense possibly damaging 0.93
R1937:Prrc2a UTSW 17 35,376,884 (GRCm39) missense probably damaging 0.99
R1995:Prrc2a UTSW 17 35,376,405 (GRCm39) missense probably damaging 0.98
R2257:Prrc2a UTSW 17 35,380,044 (GRCm39) missense unknown
R2270:Prrc2a UTSW 17 35,368,512 (GRCm39) missense possibly damaging 0.91
R3940:Prrc2a UTSW 17 35,376,474 (GRCm39) missense possibly damaging 0.86
R3973:Prrc2a UTSW 17 35,376,908 (GRCm39) missense probably damaging 0.99
R4569:Prrc2a UTSW 17 35,377,473 (GRCm39) missense unknown
R4655:Prrc2a UTSW 17 35,374,590 (GRCm39) missense probably benign 0.00
R4792:Prrc2a UTSW 17 35,375,463 (GRCm39) missense probably damaging 0.96
R4797:Prrc2a UTSW 17 35,369,018 (GRCm39) missense probably damaging 1.00
R4798:Prrc2a UTSW 17 35,369,018 (GRCm39) missense probably damaging 1.00
R4799:Prrc2a UTSW 17 35,369,018 (GRCm39) missense probably damaging 1.00
R5004:Prrc2a UTSW 17 35,368,974 (GRCm39) missense probably benign 0.11
R5129:Prrc2a UTSW 17 35,379,154 (GRCm39) missense unknown
R5155:Prrc2a UTSW 17 35,379,067 (GRCm39) splice site probably null
R5210:Prrc2a UTSW 17 35,372,596 (GRCm39) missense probably damaging 0.99
R5308:Prrc2a UTSW 17 35,380,023 (GRCm39) missense unknown
R5474:Prrc2a UTSW 17 35,378,189 (GRCm39) missense unknown
R5775:Prrc2a UTSW 17 35,377,463 (GRCm39) missense unknown
R5934:Prrc2a UTSW 17 35,369,060 (GRCm39) missense probably damaging 0.98
R6057:Prrc2a UTSW 17 35,371,716 (GRCm39) missense probably benign 0.00
R6291:Prrc2a UTSW 17 35,373,909 (GRCm39) missense probably damaging 0.99
R6535:Prrc2a UTSW 17 35,381,241 (GRCm39) missense unknown
R6622:Prrc2a UTSW 17 35,374,396 (GRCm39) missense probably damaging 0.98
R6887:Prrc2a UTSW 17 35,374,651 (GRCm39) missense probably damaging 0.99
R6971:Prrc2a UTSW 17 35,378,477 (GRCm39) splice site probably null
R7026:Prrc2a UTSW 17 35,380,803 (GRCm39) missense unknown
R7059:Prrc2a UTSW 17 35,376,364 (GRCm39) missense probably damaging 0.99
R7489:Prrc2a UTSW 17 35,381,330 (GRCm39) missense unknown
R7502:Prrc2a UTSW 17 35,381,286 (GRCm39) missense unknown
R7951:Prrc2a UTSW 17 35,379,477 (GRCm39) missense unknown
R8061:Prrc2a UTSW 17 35,380,162 (GRCm39) splice site probably benign
R8705:Prrc2a UTSW 17 35,372,542 (GRCm39) missense possibly damaging 0.92
R9016:Prrc2a UTSW 17 35,378,844 (GRCm39) missense unknown
R9310:Prrc2a UTSW 17 35,374,975 (GRCm39) missense probably benign 0.38
R9376:Prrc2a UTSW 17 35,369,598 (GRCm39) missense possibly damaging 0.85
R9645:Prrc2a UTSW 17 35,381,176 (GRCm39) critical splice donor site probably null
R9703:Prrc2a UTSW 17 35,378,320 (GRCm39) missense unknown
X0011:Prrc2a UTSW 17 35,374,874 (GRCm39) missense probably damaging 0.99
Z1177:Prrc2a UTSW 17 35,380,336 (GRCm39) missense unknown
Z1177:Prrc2a UTSW 17 35,374,676 (GRCm39) missense probably damaging 0.99
Z1177:Prrc2a UTSW 17 35,373,791 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGGCTTCTTTATAGGCCCAGC -3'
(R):5'- TCTCTTCAGGAGCGAGACTC -3'

Sequencing Primer
(F):5'- TTATAGGCCCAGCTCTTCGAGG -3'
(R):5'- GGCTAATTATCCAGGTTTTCCAGAG -3'
Posted On 2020-09-02