Incidental Mutation 'R8324:Heatr5b'
ID 644028
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene Name HEAT repeat containing 5B
Synonyms A230048G03Rik, D330050P16Rik, 2010013B10Rik
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.350) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 79060327-79142793 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79062793 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1919 (S1919P)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
AlphaFold Q8C547
Predicted Effect possibly damaging
Transcript: ENSMUST00000097281
AA Change: S1919P

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: S1919P

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 79,110,863 (GRCm39) missense probably damaging 1.00
IGL00418:Heatr5b APN 17 79,060,570 (GRCm39) missense probably damaging 1.00
IGL00786:Heatr5b APN 17 79,132,063 (GRCm39) missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 79,072,866 (GRCm39) missense probably damaging 1.00
IGL01362:Heatr5b APN 17 79,123,767 (GRCm39) splice site probably benign
IGL01419:Heatr5b APN 17 79,103,939 (GRCm39) missense probably benign 0.19
IGL01447:Heatr5b APN 17 79,137,026 (GRCm39) missense probably benign 0.00
IGL01591:Heatr5b APN 17 79,115,901 (GRCm39) missense probably benign 0.01
IGL01743:Heatr5b APN 17 79,132,069 (GRCm39) nonsense probably null
IGL01860:Heatr5b APN 17 79,115,909 (GRCm39) missense probably damaging 0.98
IGL01862:Heatr5b APN 17 79,103,914 (GRCm39) missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 79,103,926 (GRCm39) missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 79,115,855 (GRCm39) missense probably damaging 1.00
IGL02097:Heatr5b APN 17 79,124,943 (GRCm39) missense probably damaging 1.00
IGL02168:Heatr5b APN 17 79,139,020 (GRCm39) unclassified probably benign
IGL02399:Heatr5b APN 17 79,135,396 (GRCm39) missense probably damaging 0.99
IGL02540:Heatr5b APN 17 79,081,001 (GRCm39) missense probably damaging 1.00
IGL02719:Heatr5b APN 17 79,122,969 (GRCm39) missense probably damaging 1.00
IGL02824:Heatr5b APN 17 79,081,109 (GRCm39) missense probably damaging 1.00
IGL02965:Heatr5b APN 17 79,060,502 (GRCm39) missense probably benign 0.37
IGL03032:Heatr5b APN 17 79,067,928 (GRCm39) missense probably benign 0.45
IGL03243:Heatr5b APN 17 79,070,509 (GRCm39) splice site probably benign
IGL03259:Heatr5b APN 17 79,098,985 (GRCm39) missense probably damaging 1.00
IGL03349:Heatr5b APN 17 79,062,749 (GRCm39) missense probably benign 0.01
R5470_heatr5b_501 UTSW 17 79,129,008 (GRCm39) splice site probably null
R0124:Heatr5b UTSW 17 79,133,646 (GRCm39) splice site probably benign
R0285:Heatr5b UTSW 17 79,115,882 (GRCm39) missense probably benign 0.05
R0335:Heatr5b UTSW 17 79,135,375 (GRCm39) missense probably benign 0.15
R0412:Heatr5b UTSW 17 79,128,283 (GRCm39) missense probably benign 0.04
R0601:Heatr5b UTSW 17 79,075,974 (GRCm39) missense probably benign
R0725:Heatr5b UTSW 17 79,103,825 (GRCm39) missense probably benign 0.03
R1178:Heatr5b UTSW 17 79,120,698 (GRCm39) missense probably damaging 1.00
R1444:Heatr5b UTSW 17 79,062,856 (GRCm39) splice site probably benign
R1444:Heatr5b UTSW 17 79,060,622 (GRCm39) missense probably benign 0.17
R1453:Heatr5b UTSW 17 79,124,992 (GRCm39) missense probably damaging 1.00
R1469:Heatr5b UTSW 17 79,115,813 (GRCm39) missense probably damaging 1.00
R1469:Heatr5b UTSW 17 79,115,813 (GRCm39) missense probably damaging 1.00
R1506:Heatr5b UTSW 17 79,060,576 (GRCm39) missense probably damaging 1.00
R1819:Heatr5b UTSW 17 79,098,940 (GRCm39) missense probably damaging 0.98
R1835:Heatr5b UTSW 17 79,080,992 (GRCm39) missense probably damaging 1.00
R1837:Heatr5b UTSW 17 79,128,180 (GRCm39) missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 79,103,347 (GRCm39) missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 79,121,613 (GRCm39) missense probably damaging 1.00
R2037:Heatr5b UTSW 17 79,136,934 (GRCm39) nonsense probably null
R2154:Heatr5b UTSW 17 79,138,873 (GRCm39) missense probably benign 0.00
R2190:Heatr5b UTSW 17 79,109,185 (GRCm39) missense probably damaging 1.00
R2191:Heatr5b UTSW 17 79,081,106 (GRCm39) missense probably damaging 1.00
R2413:Heatr5b UTSW 17 79,064,290 (GRCm39) critical splice donor site probably null
R3424:Heatr5b UTSW 17 79,075,833 (GRCm39) missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 79,141,646 (GRCm39) missense probably damaging 1.00
R3759:Heatr5b UTSW 17 79,131,969 (GRCm39) missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 79,137,071 (GRCm39) missense probably damaging 1.00
R4127:Heatr5b UTSW 17 79,060,603 (GRCm39) missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 79,064,351 (GRCm39) missense probably benign 0.00
R4345:Heatr5b UTSW 17 79,067,940 (GRCm39) missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 79,118,025 (GRCm39) missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 79,102,548 (GRCm39) missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 79,128,130 (GRCm39) missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 79,069,689 (GRCm39) missense probably benign 0.18
R4960:Heatr5b UTSW 17 79,139,013 (GRCm39) missense probably benign 0.01
R5037:Heatr5b UTSW 17 79,131,939 (GRCm39) missense probably benign 0.00
R5051:Heatr5b UTSW 17 79,102,703 (GRCm39) missense probably damaging 1.00
R5153:Heatr5b UTSW 17 79,102,536 (GRCm39) nonsense probably null
R5328:Heatr5b UTSW 17 79,133,791 (GRCm39) missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 79,135,415 (GRCm39) missense probably benign 0.44
R5426:Heatr5b UTSW 17 79,081,142 (GRCm39) missense probably damaging 1.00
R5470:Heatr5b UTSW 17 79,129,008 (GRCm39) splice site probably null
R5472:Heatr5b UTSW 17 79,109,089 (GRCm39) missense probably damaging 1.00
R5553:Heatr5b UTSW 17 79,060,780 (GRCm39) splice site probably null
R5706:Heatr5b UTSW 17 79,074,304 (GRCm39) splice site probably null
R5804:Heatr5b UTSW 17 79,138,951 (GRCm39) missense probably damaging 0.97
R5978:Heatr5b UTSW 17 79,113,465 (GRCm39) missense probably damaging 0.99
R6122:Heatr5b UTSW 17 79,120,602 (GRCm39) missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 79,138,870 (GRCm39) missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 79,081,106 (GRCm39) missense probably damaging 1.00
R6221:Heatr5b UTSW 17 79,074,383 (GRCm39) missense probably benign 0.05
R6255:Heatr5b UTSW 17 79,110,863 (GRCm39) missense probably damaging 1.00
R6291:Heatr5b UTSW 17 79,069,526 (GRCm39) missense probably benign 0.08
R6455:Heatr5b UTSW 17 79,060,502 (GRCm39) missense probably benign 0.37
R6524:Heatr5b UTSW 17 79,121,535 (GRCm39) missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 79,070,418 (GRCm39) missense probably damaging 1.00
R6899:Heatr5b UTSW 17 79,110,938 (GRCm39) missense probably benign 0.03
R7084:Heatr5b UTSW 17 79,117,992 (GRCm39) missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 79,135,417 (GRCm39) missense probably damaging 1.00
R7148:Heatr5b UTSW 17 79,138,863 (GRCm39) missense probably damaging 0.99
R7382:Heatr5b UTSW 17 79,110,936 (GRCm39) missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 79,115,909 (GRCm39) missense probably damaging 1.00
R7436:Heatr5b UTSW 17 79,075,962 (GRCm39) missense probably benign
R7519:Heatr5b UTSW 17 79,062,646 (GRCm39) missense probably benign
R7606:Heatr5b UTSW 17 79,070,455 (GRCm39) missense probably benign
R7673:Heatr5b UTSW 17 79,103,412 (GRCm39) missense probably damaging 0.97
R7782:Heatr5b UTSW 17 79,103,370 (GRCm39) missense probably damaging 0.99
R7790:Heatr5b UTSW 17 79,126,252 (GRCm39) missense probably damaging 0.99
R7922:Heatr5b UTSW 17 79,067,988 (GRCm39) missense probably benign 0.01
R8184:Heatr5b UTSW 17 79,121,662 (GRCm39) missense probably benign 0.03
R8222:Heatr5b UTSW 17 79,109,130 (GRCm39) missense possibly damaging 0.95
R8276:Heatr5b UTSW 17 79,098,968 (GRCm39) nonsense probably null
R8430:Heatr5b UTSW 17 79,137,053 (GRCm39) missense probably damaging 0.97
R8432:Heatr5b UTSW 17 79,110,930 (GRCm39) missense probably damaging 0.99
R8672:Heatr5b UTSW 17 79,069,632 (GRCm39) missense probably damaging 1.00
R8781:Heatr5b UTSW 17 79,102,738 (GRCm39) missense probably benign 0.19
R8794:Heatr5b UTSW 17 79,123,015 (GRCm39) missense probably benign 0.00
R8808:Heatr5b UTSW 17 79,072,834 (GRCm39) missense possibly damaging 0.92
R8850:Heatr5b UTSW 17 79,109,188 (GRCm39) missense probably benign 0.02
R8893:Heatr5b UTSW 17 79,069,424 (GRCm39) splice site probably benign
R9010:Heatr5b UTSW 17 79,081,139 (GRCm39) missense probably damaging 1.00
R9041:Heatr5b UTSW 17 79,103,861 (GRCm39) missense probably benign 0.12
R9150:Heatr5b UTSW 17 79,103,448 (GRCm39) missense probably benign
R9253:Heatr5b UTSW 17 79,135,423 (GRCm39) missense probably benign 0.13
R9318:Heatr5b UTSW 17 79,072,831 (GRCm39) missense probably benign 0.07
R9448:Heatr5b UTSW 17 79,068,015 (GRCm39) missense probably benign 0.26
R9489:Heatr5b UTSW 17 79,060,679 (GRCm39) nonsense probably null
R9649:Heatr5b UTSW 17 79,141,524 (GRCm39) critical splice donor site probably null
X0022:Heatr5b UTSW 17 79,067,974 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CAGGTGTTCATTTTGGACTAGTAGC -3'
(R):5'- TTCTGGCTTTCCCACACAGTAG -3'

Sequencing Primer
(F):5'- CCAAAAGTTCCGTGCTAC -3'
(R):5'- GGCTTTCCCACACAGTAGAAATATTG -3'
Posted On 2020-09-02