Incidental Mutation 'R8324:Loxhd1'
ID 644031
Institutional Source Beutler Lab
Gene Symbol Loxhd1
Ensembl Gene ENSMUSG00000032818
Gene Name lipoxygenase homology domains 1
Synonyms sba, 1700096C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 77281958-77442341 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 77339579 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000094294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035501] [ENSMUST00000096547] [ENSMUST00000148341]
AlphaFold C8YR32
Predicted Effect probably null
Transcript: ENSMUST00000035501
SMART Domains Protein: ENSMUSP00000045450
Gene: ENSMUSG00000032818

DomainStartEndE-ValueType
Pfam:PLAT 1 53 3.2e-7 PFAM
LH2 63 176 1.1e-4 SMART
LH2 192 306 4.02e-4 SMART
LH2 320 442 3.79e-6 SMART
LH2 451 567 5.92e-6 SMART
LH2 581 696 7.67e-3 SMART
LH2 793 913 1.47e-11 SMART
low complexity region 922 931 N/A INTRINSIC
SCOP:d1lox_2 949 974 1e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000096547
SMART Domains Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818

DomainStartEndE-ValueType
LH2 43 158 5.64e-5 SMART
LH2 172 290 1.64e-9 SMART
LH2 296 409 1.1e-4 SMART
LH2 425 539 4.02e-4 SMART
LH2 553 675 3.79e-6 SMART
LH2 684 800 5.92e-6 SMART
LH2 814 936 6.91e-8 SMART
low complexity region 945 954 N/A INTRINSIC
LH2 970 1086 4.81e-7 SMART
LH2 1101 1228 5.73e-3 SMART
LH2 1255 1375 8.82e-5 SMART
Pfam:PLAT 1424 1540 5.4e-10 PFAM
LH2 1553 1666 6.41e-3 SMART
LH2 1680 1799 6.76e-6 SMART
Pfam:PLAT 1813 1929 3.8e-9 PFAM
LH2 1949 2067 7.23e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000148341
SMART Domains Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818

DomainStartEndE-ValueType
Pfam:PLAT 1 91 1.7e-11 PFAM
LH2 106 220 4.02e-4 SMART
LH2 234 356 3.79e-6 SMART
LH2 365 481 5.92e-6 SMART
LH2 495 610 7.67e-3 SMART
LH2 707 827 1.47e-11 SMART
low complexity region 836 845 N/A INTRINSIC
LH2 861 977 4.81e-7 SMART
LH2 992 1119 5.73e-3 SMART
LH2 1146 1266 8.82e-5 SMART
Pfam:PLAT 1384 1469 8.9e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,290,395 S753P probably damaging Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Antxr2 T C 5: 97,938,509 N413S probably damaging Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
Caprin1 G A 2: 103,783,181 R79* probably null Het
Cdan1 A G 2: 120,727,325 V507A probably benign Het
Cdkl3 T A 11: 52,022,879 probably null Het
Chst5 A T 8: 111,890,508 L160Q probably benign Het
Col11a1 C G 3: 114,164,410 P1111R probably damaging Het
Col6a6 T A 9: 105,755,654 E1470D probably benign Het
Cpped1 T A 16: 11,805,476 T274S probably benign Het
Ctnnbl1 G A 2: 157,779,815 E75K probably damaging Het
Cyp4f40 T C 17: 32,659,528 S15P probably benign Het
Ddx46 T C 13: 55,663,914 S643P probably damaging Het
Defb34 A G 8: 19,123,798 Q16R probably null Het
Dhrs2 T A 14: 55,238,764 V147E probably damaging Het
Dnah5 G T 15: 28,346,865 R2498L probably damaging Het
Dpp10 T A 1: 123,854,172 I93F probably benign Het
Eef1e1 T A 13: 38,655,069 D104V probably damaging Het
Egfr A G 11: 16,858,971 Y55C probably damaging Het
Egfr A C 11: 16,908,885 I955L probably damaging Het
Ehbp1l1 C A 19: 5,719,998 V426F possibly damaging Het
Fam234a C T 17: 26,218,698 V108I probably benign Het
Fzd8 T A 18: 9,214,688 M590K probably damaging Het
Gm13287 T C 4: 88,803,638 S129P probably damaging Het
Heatr5b A G 17: 78,755,364 S1919P possibly damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ikbkap C T 4: 56,772,491 E877K probably damaging Het
Itpr2 T C 6: 146,328,398 E1233G probably damaging Het
Kcnmb4 A G 10: 116,418,314 L186P probably damaging Het
Krt72 T A 15: 101,782,145 Y224F probably damaging Het
Lrguk A G 6: 34,102,571 T914A probably benign Het
Lrrtm4 A G 6: 80,021,991 T129A probably damaging Het
Mmp13 A T 9: 7,276,636 I244F possibly damaging Het
Mob1a T A 6: 83,329,974 L41Q probably damaging Het
Mtcl1 T C 17: 66,436,217 R426G probably damaging Het
Mybbp1a T C 11: 72,445,288 probably null Het
Myh9 A G 15: 77,788,917 probably null Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Ncapg T G 5: 45,695,668 H825Q probably damaging Het
Olfml1 T C 7: 107,590,363 S212P probably benign Het
Olfr656 G A 7: 104,618,114 R145H probably benign Het
Pak2 T C 16: 32,052,211 N51S probably benign Het
Papln T C 12: 83,786,619 Y1132H probably damaging Het
Pax3 T A 1: 78,193,789 R134S probably damaging Het
Pdzrn4 A G 15: 92,770,937 E990G probably damaging Het
Peak1 A T 9: 56,207,476 W1394R probably damaging Het
Pkn2 T C 3: 142,829,010 N285D probably benign Het
Pramef12 A C 4: 144,395,857 L39R probably damaging Het
Prrc2a A G 17: 35,156,984 S897P possibly damaging Het
Rad51 A G 2: 119,123,831 T131A possibly damaging Het
Rc3h2 T A 2: 37,400,726 T255S possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rictor T A 15: 6,745,562 V125E probably damaging Het
Rps6ka5 C T 12: 100,558,487 D664N possibly damaging Het
Rreb1 T A 13: 37,947,621 W1584R probably damaging Het
Rxra T C 2: 27,741,183 I142T probably damaging Het
Sall2 T C 14: 52,312,886 T951A probably benign Het
Slc15a2 T G 16: 36,759,307 N359T probably damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc6a13 T C 6: 121,337,414 *603Q probably null Het
Sptb T C 12: 76,619,162 D894G possibly damaging Het
Srgn A G 10: 62,507,665 L17P probably damaging Het
Tmprss9 T C 10: 80,897,371 probably null Het
Trav9n-4 T C 14: 53,294,946 F86L probably benign Het
Trp63 A G 16: 25,876,734 Y482C unknown Het
Ttc9b G T 7: 27,653,969 A15S probably damaging Het
Urb1 A T 16: 90,791,190 I410N probably damaging Het
Vmn2r82 A T 10: 79,378,893 K237* probably null Het
Wwox G A 8: 114,489,005 probably null Het
Other mutations in Loxhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Loxhd1 APN 18 77395450 missense probably damaging 0.99
IGL00490:Loxhd1 APN 18 77431074 missense possibly damaging 0.94
IGL00507:Loxhd1 APN 18 77332567 missense probably benign 0.03
IGL00546:Loxhd1 APN 18 77405976 missense probably damaging 0.97
IGL01369:Loxhd1 APN 18 77329201 missense possibly damaging 0.85
IGL01767:Loxhd1 APN 18 77286424 missense possibly damaging 0.71
IGL02245:Loxhd1 APN 18 77340101 missense possibly damaging 0.71
IGL02388:Loxhd1 APN 18 77369137 missense probably benign 0.18
IGL02410:Loxhd1 APN 18 77402952 missense probably benign 0.02
IGL02593:Loxhd1 APN 18 77410539 missense possibly damaging 0.91
IGL02632:Loxhd1 APN 18 77405932 missense probably damaging 0.99
IGL02692:Loxhd1 APN 18 77356913 missense probably damaging 0.99
IGL02796:Loxhd1 APN 18 77369115 splice site probably benign
IGL03032:Loxhd1 APN 18 77286473 missense possibly damaging 0.93
IGL03074:Loxhd1 APN 18 77441784 missense possibly damaging 0.75
IGL03094:Loxhd1 APN 18 77431113 missense possibly damaging 0.88
IGL03118:Loxhd1 APN 18 77380464 missense probably damaging 1.00
IGL03232:Loxhd1 APN 18 77408750 missense probably damaging 1.00
IGL03377:Loxhd1 APN 18 77441673 missense possibly damaging 0.91
H8562:Loxhd1 UTSW 18 77341931 missense possibly damaging 0.93
PIT4494001:Loxhd1 UTSW 18 77441768 missense probably damaging 0.99
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0048:Loxhd1 UTSW 18 77408778 missense probably damaging 0.99
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0208:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0323:Loxhd1 UTSW 18 77369137 missense probably benign 0.18
R0332:Loxhd1 UTSW 18 77383830 splice site probably null
R0367:Loxhd1 UTSW 18 77425757 splice site probably benign
R0709:Loxhd1 UTSW 18 77404969 missense probably benign 0.23
R0783:Loxhd1 UTSW 18 77429984 missense possibly damaging 0.58
R1132:Loxhd1 UTSW 18 77429943 missense possibly damaging 0.71
R1232:Loxhd1 UTSW 18 77406003 critical splice donor site probably null
R1331:Loxhd1 UTSW 18 77402936 missense possibly damaging 0.86
R1465:Loxhd1 UTSW 18 77380573 splice site probably null
R1465:Loxhd1 UTSW 18 77380573 splice site probably null
R1501:Loxhd1 UTSW 18 77356832 missense probably damaging 1.00
R1640:Loxhd1 UTSW 18 77402563 missense probably damaging 1.00
R1656:Loxhd1 UTSW 18 77321668 missense possibly damaging 0.71
R1671:Loxhd1 UTSW 18 77404802 missense probably damaging 1.00
R1725:Loxhd1 UTSW 18 77293241 missense probably benign 0.32
R1735:Loxhd1 UTSW 18 77404889 missense probably damaging 0.98
R1796:Loxhd1 UTSW 18 77405907 missense probably damaging 0.96
R1796:Loxhd1 UTSW 18 77425639 missense possibly damaging 0.88
R1800:Loxhd1 UTSW 18 77402502 missense probably damaging 1.00
R1848:Loxhd1 UTSW 18 77281971 missense possibly damaging 0.53
R1912:Loxhd1 UTSW 18 77340137 missense probably benign 0.32
R1945:Loxhd1 UTSW 18 77404808 missense probably damaging 1.00
R1978:Loxhd1 UTSW 18 77321642 missense possibly damaging 0.86
R1997:Loxhd1 UTSW 18 77295769 missense probably damaging 0.98
R2086:Loxhd1 UTSW 18 77384946 missense probably damaging 1.00
R2153:Loxhd1 UTSW 18 77356166 missense possibly damaging 0.72
R3124:Loxhd1 UTSW 18 77431078 missense probably damaging 0.97
R3896:Loxhd1 UTSW 18 77382023 missense possibly damaging 0.65
R3907:Loxhd1 UTSW 18 77408768 missense possibly damaging 0.60
R3980:Loxhd1 UTSW 18 77414159 missense probably damaging 1.00
R4165:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4166:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4176:Loxhd1 UTSW 18 77331059 missense possibly damaging 0.53
R4345:Loxhd1 UTSW 18 77399001 missense possibly damaging 0.89
R4354:Loxhd1 UTSW 18 77395427 missense probably damaging 1.00
R4385:Loxhd1 UTSW 18 77372911 missense probably damaging 0.99
R4402:Loxhd1 UTSW 18 77441760 missense possibly damaging 0.94
R4404:Loxhd1 UTSW 18 77431132 missense probably damaging 1.00
R4456:Loxhd1 UTSW 18 77399089 missense probably damaging 1.00
R4525:Loxhd1 UTSW 18 77356912 missense probably damaging 0.98
R4605:Loxhd1 UTSW 18 77405946 missense probably benign 0.00
R4661:Loxhd1 UTSW 18 77402885 missense possibly damaging 0.79
R4698:Loxhd1 UTSW 18 77372291 missense possibly damaging 0.82
R4725:Loxhd1 UTSW 18 77395457 missense probably damaging 1.00
R4820:Loxhd1 UTSW 18 77384967 missense probably damaging 1.00
R5163:Loxhd1 UTSW 18 77361736 missense possibly damaging 0.92
R5288:Loxhd1 UTSW 18 77363612 missense probably damaging 1.00
R5328:Loxhd1 UTSW 18 77410572 missense probably damaging 1.00
R5329:Loxhd1 UTSW 18 77332682 missense probably damaging 0.98
R5347:Loxhd1 UTSW 18 77366541 missense probably damaging 1.00
R5589:Loxhd1 UTSW 18 77342055 missense possibly damaging 0.86
R5616:Loxhd1 UTSW 18 77404951 missense probably damaging 1.00
R5703:Loxhd1 UTSW 18 77356877 missense probably damaging 1.00
R5837:Loxhd1 UTSW 18 77286409 missense possibly damaging 0.71
R5888:Loxhd1 UTSW 18 77402515 missense probably damaging 0.99
R6021:Loxhd1 UTSW 18 77412250 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6153:Loxhd1 UTSW 18 77295758 missense possibly damaging 0.71
R6174:Loxhd1 UTSW 18 77412178 missense probably damaging 1.00
R6265:Loxhd1 UTSW 18 77361730 missense probably damaging 0.99
R6377:Loxhd1 UTSW 18 77380432 missense probably damaging 1.00
R6530:Loxhd1 UTSW 18 77412151 missense probably benign 0.30
R6555:Loxhd1 UTSW 18 77293269 missense possibly damaging 0.51
R6782:Loxhd1 UTSW 18 77431177 missense probably damaging 0.99
R6834:Loxhd1 UTSW 18 77441526 missense probably damaging 1.00
R7000:Loxhd1 UTSW 18 77372433 critical splice donor site probably null
R7112:Loxhd1 UTSW 18 77388514 missense probably damaging 1.00
R7203:Loxhd1 UTSW 18 77414196 missense probably damaging 0.97
R7206:Loxhd1 UTSW 18 77441817 missense probably damaging 0.97
R7260:Loxhd1 UTSW 18 77332642 missense possibly damaging 0.93
R7432:Loxhd1 UTSW 18 77295851 missense possibly damaging 0.51
R7475:Loxhd1 UTSW 18 77412305 missense possibly damaging 0.83
R7555:Loxhd1 UTSW 18 77395365 missense probably damaging 0.99
R7590:Loxhd1 UTSW 18 77321634 missense possibly damaging 0.84
R7612:Loxhd1 UTSW 18 77429975 missense possibly damaging 0.95
R7626:Loxhd1 UTSW 18 77431186 missense possibly damaging 0.75
R7768:Loxhd1 UTSW 18 77384941 missense probably damaging 0.99
R7791:Loxhd1 UTSW 18 77383729 missense probably damaging 1.00
R7829:Loxhd1 UTSW 18 77408787 missense probably damaging 0.99
R7884:Loxhd1 UTSW 18 77431213 missense probably damaging 0.98
R7960:Loxhd1 UTSW 18 77385050 missense probably damaging 0.99
R7986:Loxhd1 UTSW 18 77375194 missense possibly damaging 0.88
R8042:Loxhd1 UTSW 18 77431192 missense probably damaging 0.99
R8084:Loxhd1 UTSW 18 77340149 missense possibly damaging 0.71
R8088:Loxhd1 UTSW 18 77342013 missense possibly damaging 0.52
R8100:Loxhd1 UTSW 18 77404816 missense possibly damaging 0.69
R8139:Loxhd1 UTSW 18 77380496 missense possibly damaging 0.95
R8152:Loxhd1 UTSW 18 77388399 missense possibly damaging 0.62
R8199:Loxhd1 UTSW 18 77381638 missense possibly damaging 0.77
R8246:Loxhd1 UTSW 18 77363546 missense possibly damaging 0.71
R8263:Loxhd1 UTSW 18 77375162 missense probably damaging 1.00
R8342:Loxhd1 UTSW 18 77405985 missense possibly damaging 0.88
R8401:Loxhd1 UTSW 18 77380460 missense probably damaging 1.00
R8480:Loxhd1 UTSW 18 77431131 missense probably damaging 1.00
R8490:Loxhd1 UTSW 18 77441466 missense possibly damaging 0.96
R8807:Loxhd1 UTSW 18 77356772 missense possibly damaging 0.93
R8961:Loxhd1 UTSW 18 77385069 missense probably damaging 1.00
R8974:Loxhd1 UTSW 18 77431203 missense possibly damaging 0.88
R9079:Loxhd1 UTSW 18 77402897 missense probably benign
R9284:Loxhd1 UTSW 18 77414130 missense probably damaging 0.97
R9312:Loxhd1 UTSW 18 77410589 missense probably benign 0.05
R9619:Loxhd1 UTSW 18 77356175 missense probably benign 0.32
X0020:Loxhd1 UTSW 18 77339562 nonsense probably null
X0024:Loxhd1 UTSW 18 77395403 missense probably damaging 1.00
X0062:Loxhd1 UTSW 18 77441516 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACACAGGAGACATGTGCTG -3'
(R):5'- CTTAGTGGCTAAAGATGGACTGTG -3'

Sequencing Primer
(F):5'- ACATGTGCTGTCTGCCTCTATAGG -3'
(R):5'- TTTTAGCAGTAGACAAGCGCTGAC -3'
Posted On 2020-09-02