Mutagenetix > Incidental Mutation

Incidental Mutation 'R8324:Loxhd1'

644031

Institutional Source

Beutler Lab

Gene Symbol

Loxhd1

Ensembl Gene

ENSMUSG00000032818

Gene Name

lipoxygenase homology domains 1

Synonyms

sba, 1700096C21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.167) question?

Stock #

R8324 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

77281958-77442341 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 77339579 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000094294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035501] [ENSMUST00000096547] [ENSMUST00000148341]

AlphaFold

C8YR32

Predicted Effect

probably null
Transcript: ENSMUST00000035501

SMART Domains

Protein: ENSMUSP00000045450
Gene: ENSMUSG00000032818

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	53	3.2e-7	PFAM
LH2	63	176	1.1e-4	SMART
LH2	192	306	4.02e-4	SMART
LH2	320	442	3.79e-6	SMART
LH2	451	567	5.92e-6	SMART
LH2	581	696	7.67e-3	SMART
LH2	793	913	1.47e-11	SMART
low complexity region	922	931	N/A	INTRINSIC
SCOP:d1lox_2	949	974	1e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000096547

SMART Domains

Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818

Domain	Start	End	E-Value	Type
LH2	43	158	5.64e-5	SMART
LH2	172	290	1.64e-9	SMART
LH2	296	409	1.1e-4	SMART
LH2	425	539	4.02e-4	SMART
LH2	553	675	3.79e-6	SMART
LH2	684	800	5.92e-6	SMART
LH2	814	936	6.91e-8	SMART
low complexity region	945	954	N/A	INTRINSIC
LH2	970	1086	4.81e-7	SMART
LH2	1101	1228	5.73e-3	SMART
LH2	1255	1375	8.82e-5	SMART
Pfam:PLAT	1424	1540	5.4e-10	PFAM
LH2	1553	1666	6.41e-3	SMART
LH2	1680	1799	6.76e-6	SMART
Pfam:PLAT	1813	1929	3.8e-9	PFAM
LH2	1949	2067	7.23e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000148341

SMART Domains

Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	91	1.7e-11	PFAM
LH2	106	220	4.02e-4	SMART
LH2	234	356	3.79e-6	SMART
LH2	365	481	5.92e-6	SMART
LH2	495	610	7.67e-3	SMART
LH2	707	827	1.47e-11	SMART
low complexity region	836	845	N/A	INTRINSIC
LH2	861	977	4.81e-7	SMART
LH2	992	1119	5.73e-3	SMART
LH2	1146	1266	8.82e-5	SMART
Pfam:PLAT	1384	1469	8.9e-14	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,290,395	S753P	probably damaging	Het
Acan	A	G	7: 79,091,056	E390G	probably damaging	Het
Antxr2	T	C	5: 97,938,509	N413S	probably damaging	Het
Bace2	C	T	16: 97,356,908	A36V	possibly damaging	Het
Caprin1	G	A	2: 103,783,181	R79*	probably null	Het
Cdan1	A	G	2: 120,727,325	V507A	probably benign	Het
Cdkl3	T	A	11: 52,022,879		probably null	Het
Chst5	A	T	8: 111,890,508	L160Q	probably benign	Het
Col11a1	C	G	3: 114,164,410	P1111R	probably damaging	Het
Col6a6	T	A	9: 105,755,654	E1470D	probably benign	Het
Cpped1	T	A	16: 11,805,476	T274S	probably benign	Het
Ctnnbl1	G	A	2: 157,779,815	E75K	probably damaging	Het
Cyp4f40	T	C	17: 32,659,528	S15P	probably benign	Het
Ddx46	T	C	13: 55,663,914	S643P	probably damaging	Het
Defb34	A	G	8: 19,123,798	Q16R	probably null	Het
Dhrs2	T	A	14: 55,238,764	V147E	probably damaging	Het
Dnah5	G	T	15: 28,346,865	R2498L	probably damaging	Het
Dpp10	T	A	1: 123,854,172	I93F	probably benign	Het
Eef1e1	T	A	13: 38,655,069	D104V	probably damaging	Het
Egfr	A	G	11: 16,858,971	Y55C	probably damaging	Het
Egfr	A	C	11: 16,908,885	I955L	probably damaging	Het
Ehbp1l1	C	A	19: 5,719,998	V426F	possibly damaging	Het
Fam234a	C	T	17: 26,218,698	V108I	probably benign	Het
Fzd8	T	A	18: 9,214,688	M590K	probably damaging	Het
Gm13287	T	C	4: 88,803,638	S129P	probably damaging	Het
Heatr5b	A	G	17: 78,755,364	S1919P	possibly damaging	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Ikbkap	C	T	4: 56,772,491	E877K	probably damaging	Het
Itpr2	T	C	6: 146,328,398	E1233G	probably damaging	Het
Kcnmb4	A	G	10: 116,418,314	L186P	probably damaging	Het
Krt72	T	A	15: 101,782,145	Y224F	probably damaging	Het
Lrguk	A	G	6: 34,102,571	T914A	probably benign	Het
Lrrtm4	A	G	6: 80,021,991	T129A	probably damaging	Het
Mmp13	A	T	9: 7,276,636	I244F	possibly damaging	Het
Mob1a	T	A	6: 83,329,974	L41Q	probably damaging	Het
Mtcl1	T	C	17: 66,436,217	R426G	probably damaging	Het
Mybbp1a	T	C	11: 72,445,288		probably null	Het
Myh9	A	G	15: 77,788,917		probably null	Het
Myo1d	T	A	11: 80,557,521	D926V	probably damaging	Het
Ncapg	T	G	5: 45,695,668	H825Q	probably damaging	Het
Olfml1	T	C	7: 107,590,363	S212P	probably benign	Het
Olfr656	G	A	7: 104,618,114	R145H	probably benign	Het
Pak2	T	C	16: 32,052,211	N51S	probably benign	Het
Papln	T	C	12: 83,786,619	Y1132H	probably damaging	Het
Pax3	T	A	1: 78,193,789	R134S	probably damaging	Het
Pdzrn4	A	G	15: 92,770,937	E990G	probably damaging	Het
Peak1	A	T	9: 56,207,476	W1394R	probably damaging	Het
Pkn2	T	C	3: 142,829,010	N285D	probably benign	Het
Pramef12	A	C	4: 144,395,857	L39R	probably damaging	Het
Prrc2a	A	G	17: 35,156,984	S897P	possibly damaging	Het
Rad51	A	G	2: 119,123,831	T131A	possibly damaging	Het
Rc3h2	T	A	2: 37,400,726	T255S	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rictor	T	A	15: 6,745,562	V125E	probably damaging	Het
Rps6ka5	C	T	12: 100,558,487	D664N	possibly damaging	Het
Rreb1	T	A	13: 37,947,621	W1584R	probably damaging	Het
Rxra	T	C	2: 27,741,183	I142T	probably damaging	Het
Sall2	T	C	14: 52,312,886	T951A	probably benign	Het
Slc15a2	T	G	16: 36,759,307	N359T	probably damaging	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Slc6a13	T	C	6: 121,337,414	*603Q	probably null	Het
Sptb	T	C	12: 76,619,162	D894G	possibly damaging	Het
Srgn	A	G	10: 62,507,665	L17P	probably damaging	Het
Tmprss9	T	C	10: 80,897,371		probably null	Het
Trav9n-4	T	C	14: 53,294,946	F86L	probably benign	Het
Trp63	A	G	16: 25,876,734	Y482C	unknown	Het
Ttc9b	G	T	7: 27,653,969	A15S	probably damaging	Het
Urb1	A	T	16: 90,791,190	I410N	probably damaging	Het
Vmn2r82	A	T	10: 79,378,893	K237*	probably null	Het
Wwox	G	A	8: 114,489,005		probably null	Het

Other mutations in Loxhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Loxhd1	APN	18	77395450	missense	probably damaging	0.99
IGL00490:Loxhd1	APN	18	77431074	missense	possibly damaging	0.94
IGL00507:Loxhd1	APN	18	77332567	missense	probably benign	0.03
IGL00546:Loxhd1	APN	18	77405976	missense	probably damaging	0.97
IGL01369:Loxhd1	APN	18	77329201	missense	possibly damaging	0.85
IGL01767:Loxhd1	APN	18	77286424	missense	possibly damaging	0.71
IGL02245:Loxhd1	APN	18	77340101	missense	possibly damaging	0.71
IGL02388:Loxhd1	APN	18	77369137	missense	probably benign	0.18
IGL02410:Loxhd1	APN	18	77402952	missense	probably benign	0.02
IGL02593:Loxhd1	APN	18	77410539	missense	possibly damaging	0.91
IGL02632:Loxhd1	APN	18	77405932	missense	probably damaging	0.99
IGL02692:Loxhd1	APN	18	77356913	missense	probably damaging	0.99
IGL02796:Loxhd1	APN	18	77369115	splice site	probably benign
IGL03032:Loxhd1	APN	18	77286473	missense	possibly damaging	0.93
IGL03074:Loxhd1	APN	18	77441784	missense	possibly damaging	0.75
IGL03094:Loxhd1	APN	18	77431113	missense	possibly damaging	0.88
IGL03118:Loxhd1	APN	18	77380464	missense	probably damaging	1.00
IGL03232:Loxhd1	APN	18	77408750	missense	probably damaging	1.00
IGL03377:Loxhd1	APN	18	77441673	missense	possibly damaging	0.91
H8562:Loxhd1	UTSW	18	77341931	missense	possibly damaging	0.93
PIT4494001:Loxhd1	UTSW	18	77441768	missense	probably damaging	0.99
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0048:Loxhd1	UTSW	18	77408778	missense	probably damaging	0.99
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0208:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0323:Loxhd1	UTSW	18	77369137	missense	probably benign	0.18
R0332:Loxhd1	UTSW	18	77383830	splice site	probably null
R0367:Loxhd1	UTSW	18	77425757	splice site	probably benign
R0709:Loxhd1	UTSW	18	77404969	missense	probably benign	0.23
R0783:Loxhd1	UTSW	18	77429984	missense	possibly damaging	0.58
R1132:Loxhd1	UTSW	18	77429943	missense	possibly damaging	0.71
R1232:Loxhd1	UTSW	18	77406003	critical splice donor site	probably null
R1331:Loxhd1	UTSW	18	77402936	missense	possibly damaging	0.86
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1501:Loxhd1	UTSW	18	77356832	missense	probably damaging	1.00
R1640:Loxhd1	UTSW	18	77402563	missense	probably damaging	1.00
R1656:Loxhd1	UTSW	18	77321668	missense	possibly damaging	0.71
R1671:Loxhd1	UTSW	18	77404802	missense	probably damaging	1.00
R1725:Loxhd1	UTSW	18	77293241	missense	probably benign	0.32
R1735:Loxhd1	UTSW	18	77404889	missense	probably damaging	0.98
R1796:Loxhd1	UTSW	18	77405907	missense	probably damaging	0.96
R1796:Loxhd1	UTSW	18	77425639	missense	possibly damaging	0.88
R1800:Loxhd1	UTSW	18	77402502	missense	probably damaging	1.00
R1848:Loxhd1	UTSW	18	77281971	missense	possibly damaging	0.53
R1912:Loxhd1	UTSW	18	77340137	missense	probably benign	0.32
R1945:Loxhd1	UTSW	18	77404808	missense	probably damaging	1.00
R1978:Loxhd1	UTSW	18	77321642	missense	possibly damaging	0.86
R1997:Loxhd1	UTSW	18	77295769	missense	probably damaging	0.98
R2086:Loxhd1	UTSW	18	77384946	missense	probably damaging	1.00
R2153:Loxhd1	UTSW	18	77356166	missense	possibly damaging	0.72
R3124:Loxhd1	UTSW	18	77431078	missense	probably damaging	0.97
R3896:Loxhd1	UTSW	18	77382023	missense	possibly damaging	0.65
R3907:Loxhd1	UTSW	18	77408768	missense	possibly damaging	0.60
R3980:Loxhd1	UTSW	18	77414159	missense	probably damaging	1.00
R4165:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4166:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4176:Loxhd1	UTSW	18	77331059	missense	possibly damaging	0.53
R4345:Loxhd1	UTSW	18	77399001	missense	possibly damaging	0.89
R4354:Loxhd1	UTSW	18	77395427	missense	probably damaging	1.00
R4385:Loxhd1	UTSW	18	77372911	missense	probably damaging	0.99
R4402:Loxhd1	UTSW	18	77441760	missense	possibly damaging	0.94
R4404:Loxhd1	UTSW	18	77431132	missense	probably damaging	1.00
R4456:Loxhd1	UTSW	18	77399089	missense	probably damaging	1.00
R4525:Loxhd1	UTSW	18	77356912	missense	probably damaging	0.98
R4605:Loxhd1	UTSW	18	77405946	missense	probably benign	0.00
R4661:Loxhd1	UTSW	18	77402885	missense	possibly damaging	0.79
R4698:Loxhd1	UTSW	18	77372291	missense	possibly damaging	0.82
R4725:Loxhd1	UTSW	18	77395457	missense	probably damaging	1.00
R4820:Loxhd1	UTSW	18	77384967	missense	probably damaging	1.00
R5163:Loxhd1	UTSW	18	77361736	missense	possibly damaging	0.92
R5288:Loxhd1	UTSW	18	77363612	missense	probably damaging	1.00
R5328:Loxhd1	UTSW	18	77410572	missense	probably damaging	1.00
R5329:Loxhd1	UTSW	18	77332682	missense	probably damaging	0.98
R5347:Loxhd1	UTSW	18	77366541	missense	probably damaging	1.00
R5589:Loxhd1	UTSW	18	77342055	missense	possibly damaging	0.86
R5616:Loxhd1	UTSW	18	77404951	missense	probably damaging	1.00
R5703:Loxhd1	UTSW	18	77356877	missense	probably damaging	1.00
R5837:Loxhd1	UTSW	18	77286409	missense	possibly damaging	0.71
R5888:Loxhd1	UTSW	18	77402515	missense	probably damaging	0.99
R6021:Loxhd1	UTSW	18	77412250	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6153:Loxhd1	UTSW	18	77295758	missense	possibly damaging	0.71
R6174:Loxhd1	UTSW	18	77412178	missense	probably damaging	1.00
R6265:Loxhd1	UTSW	18	77361730	missense	probably damaging	0.99
R6377:Loxhd1	UTSW	18	77380432	missense	probably damaging	1.00
R6530:Loxhd1	UTSW	18	77412151	missense	probably benign	0.30
R6555:Loxhd1	UTSW	18	77293269	missense	possibly damaging	0.51
R6782:Loxhd1	UTSW	18	77431177	missense	probably damaging	0.99
R6834:Loxhd1	UTSW	18	77441526	missense	probably damaging	1.00
R7000:Loxhd1	UTSW	18	77372433	critical splice donor site	probably null
R7112:Loxhd1	UTSW	18	77388514	missense	probably damaging	1.00
R7203:Loxhd1	UTSW	18	77414196	missense	probably damaging	0.97
R7206:Loxhd1	UTSW	18	77441817	missense	probably damaging	0.97
R7260:Loxhd1	UTSW	18	77332642	missense	possibly damaging	0.93
R7432:Loxhd1	UTSW	18	77295851	missense	possibly damaging	0.51
R7475:Loxhd1	UTSW	18	77412305	missense	possibly damaging	0.83
R7555:Loxhd1	UTSW	18	77395365	missense	probably damaging	0.99
R7590:Loxhd1	UTSW	18	77321634	missense	possibly damaging	0.84
R7612:Loxhd1	UTSW	18	77429975	missense	possibly damaging	0.95
R7626:Loxhd1	UTSW	18	77431186	missense	possibly damaging	0.75
R7768:Loxhd1	UTSW	18	77384941	missense	probably damaging	0.99
R7791:Loxhd1	UTSW	18	77383729	missense	probably damaging	1.00
R7829:Loxhd1	UTSW	18	77408787	missense	probably damaging	0.99
R7884:Loxhd1	UTSW	18	77431213	missense	probably damaging	0.98
R7960:Loxhd1	UTSW	18	77385050	missense	probably damaging	0.99
R7986:Loxhd1	UTSW	18	77375194	missense	possibly damaging	0.88
R8042:Loxhd1	UTSW	18	77431192	missense	probably damaging	0.99
R8084:Loxhd1	UTSW	18	77340149	missense	possibly damaging	0.71
R8088:Loxhd1	UTSW	18	77342013	missense	possibly damaging	0.52
R8100:Loxhd1	UTSW	18	77404816	missense	possibly damaging	0.69
R8139:Loxhd1	UTSW	18	77380496	missense	possibly damaging	0.95
R8152:Loxhd1	UTSW	18	77388399	missense	possibly damaging	0.62
R8199:Loxhd1	UTSW	18	77381638	missense	possibly damaging	0.77
R8246:Loxhd1	UTSW	18	77363546	missense	possibly damaging	0.71
R8263:Loxhd1	UTSW	18	77375162	missense	probably damaging	1.00
R8342:Loxhd1	UTSW	18	77405985	missense	possibly damaging	0.88
R8401:Loxhd1	UTSW	18	77380460	missense	probably damaging	1.00
R8480:Loxhd1	UTSW	18	77431131	missense	probably damaging	1.00
R8490:Loxhd1	UTSW	18	77441466	missense	possibly damaging	0.96
R8807:Loxhd1	UTSW	18	77356772	missense	possibly damaging	0.93
R8961:Loxhd1	UTSW	18	77385069	missense	probably damaging	1.00
R8974:Loxhd1	UTSW	18	77431203	missense	possibly damaging	0.88
R9079:Loxhd1	UTSW	18	77402897	missense	probably benign
R9284:Loxhd1	UTSW	18	77414130	missense	probably damaging	0.97
R9312:Loxhd1	UTSW	18	77410589	missense	probably benign	0.05
R9619:Loxhd1	UTSW	18	77356175	missense	probably benign	0.32
X0020:Loxhd1	UTSW	18	77339562	nonsense	probably null
X0024:Loxhd1	UTSW	18	77395403	missense	probably damaging	1.00
X0062:Loxhd1	UTSW	18	77441516	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCACACAGGAGACATGTGCTG -3'
(R):5'- CTTAGTGGCTAAAGATGGACTGTG -3'

Sequencing Primer
(F):5'- ACATGTGCTGTCTGCCTCTATAGG -3'
(R):5'- TTTTAGCAGTAGACAAGCGCTGAC -3'

Posted On

2020-09-02