Incidental Mutation 'R8324:Loxhd1'
ID 644031
Institutional Source Beutler Lab
Gene Symbol Loxhd1
Ensembl Gene ENSMUSG00000032818
Gene Name lipoxygenase homology domains 1
Synonyms 1700096C21Rik, sba
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.163) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 77369654-77530626 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 77427275 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000094294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035501] [ENSMUST00000096547] [ENSMUST00000148341]
AlphaFold C8YR32
Predicted Effect probably null
Transcript: ENSMUST00000035501
SMART Domains Protein: ENSMUSP00000045450
Gene: ENSMUSG00000032818

DomainStartEndE-ValueType
Pfam:PLAT 1 53 3.2e-7 PFAM
LH2 63 176 1.1e-4 SMART
LH2 192 306 4.02e-4 SMART
LH2 320 442 3.79e-6 SMART
LH2 451 567 5.92e-6 SMART
LH2 581 696 7.67e-3 SMART
LH2 793 913 1.47e-11 SMART
low complexity region 922 931 N/A INTRINSIC
SCOP:d1lox_2 949 974 1e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000096547
SMART Domains Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818

DomainStartEndE-ValueType
LH2 43 158 5.64e-5 SMART
LH2 172 290 1.64e-9 SMART
LH2 296 409 1.1e-4 SMART
LH2 425 539 4.02e-4 SMART
LH2 553 675 3.79e-6 SMART
LH2 684 800 5.92e-6 SMART
LH2 814 936 6.91e-8 SMART
low complexity region 945 954 N/A INTRINSIC
LH2 970 1086 4.81e-7 SMART
LH2 1101 1228 5.73e-3 SMART
LH2 1255 1375 8.82e-5 SMART
Pfam:PLAT 1424 1540 5.4e-10 PFAM
LH2 1553 1666 6.41e-3 SMART
LH2 1680 1799 6.76e-6 SMART
Pfam:PLAT 1813 1929 3.8e-9 PFAM
LH2 1949 2067 7.23e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000148341
SMART Domains Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818

DomainStartEndE-ValueType
Pfam:PLAT 1 91 1.7e-11 PFAM
LH2 106 220 4.02e-4 SMART
LH2 234 356 3.79e-6 SMART
LH2 365 481 5.92e-6 SMART
LH2 495 610 7.67e-3 SMART
LH2 707 827 1.47e-11 SMART
low complexity region 836 845 N/A INTRINSIC
LH2 861 977 4.81e-7 SMART
LH2 992 1119 5.73e-3 SMART
LH2 1146 1266 8.82e-5 SMART
Pfam:PLAT 1384 1469 8.9e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Ehbp1l1 C A 19: 5,770,026 (GRCm39) V426F possibly damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Loxhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Loxhd1 APN 18 77,483,146 (GRCm39) missense probably damaging 0.99
IGL00490:Loxhd1 APN 18 77,518,770 (GRCm39) missense possibly damaging 0.94
IGL00507:Loxhd1 APN 18 77,420,263 (GRCm39) missense probably benign 0.03
IGL00546:Loxhd1 APN 18 77,493,672 (GRCm39) missense probably damaging 0.97
IGL01369:Loxhd1 APN 18 77,416,897 (GRCm39) missense possibly damaging 0.85
IGL01767:Loxhd1 APN 18 77,374,120 (GRCm39) missense possibly damaging 0.71
IGL02245:Loxhd1 APN 18 77,427,797 (GRCm39) missense possibly damaging 0.71
IGL02388:Loxhd1 APN 18 77,456,833 (GRCm39) missense probably benign 0.18
IGL02410:Loxhd1 APN 18 77,490,648 (GRCm39) missense probably benign 0.02
IGL02593:Loxhd1 APN 18 77,498,235 (GRCm39) missense possibly damaging 0.91
IGL02632:Loxhd1 APN 18 77,493,628 (GRCm39) missense probably damaging 0.99
IGL02692:Loxhd1 APN 18 77,444,609 (GRCm39) missense probably damaging 0.99
IGL02796:Loxhd1 APN 18 77,456,811 (GRCm39) splice site probably benign
IGL03032:Loxhd1 APN 18 77,374,169 (GRCm39) missense possibly damaging 0.93
IGL03074:Loxhd1 APN 18 77,529,480 (GRCm39) missense possibly damaging 0.75
IGL03094:Loxhd1 APN 18 77,518,809 (GRCm39) missense possibly damaging 0.88
IGL03118:Loxhd1 APN 18 77,468,160 (GRCm39) missense probably damaging 1.00
IGL03232:Loxhd1 APN 18 77,496,446 (GRCm39) missense probably damaging 1.00
IGL03377:Loxhd1 APN 18 77,529,369 (GRCm39) missense possibly damaging 0.91
H8562:Loxhd1 UTSW 18 77,429,627 (GRCm39) missense possibly damaging 0.93
PIT4494001:Loxhd1 UTSW 18 77,529,464 (GRCm39) missense probably damaging 0.99
R0003:Loxhd1 UTSW 18 77,427,196 (GRCm39) missense probably damaging 0.98
R0003:Loxhd1 UTSW 18 77,427,196 (GRCm39) missense probably damaging 0.98
R0048:Loxhd1 UTSW 18 77,496,474 (GRCm39) missense probably damaging 0.99
R0049:Loxhd1 UTSW 18 77,468,256 (GRCm39) splice site probably benign
R0049:Loxhd1 UTSW 18 77,468,256 (GRCm39) splice site probably benign
R0206:Loxhd1 UTSW 18 77,492,562 (GRCm39) missense possibly damaging 0.90
R0206:Loxhd1 UTSW 18 77,492,562 (GRCm39) missense possibly damaging 0.90
R0208:Loxhd1 UTSW 18 77,492,562 (GRCm39) missense possibly damaging 0.90
R0323:Loxhd1 UTSW 18 77,456,833 (GRCm39) missense probably benign 0.18
R0332:Loxhd1 UTSW 18 77,471,526 (GRCm39) splice site probably null
R0367:Loxhd1 UTSW 18 77,513,453 (GRCm39) splice site probably benign
R0709:Loxhd1 UTSW 18 77,492,665 (GRCm39) missense probably benign 0.23
R0783:Loxhd1 UTSW 18 77,517,680 (GRCm39) missense possibly damaging 0.58
R1132:Loxhd1 UTSW 18 77,517,639 (GRCm39) missense possibly damaging 0.71
R1232:Loxhd1 UTSW 18 77,493,699 (GRCm39) critical splice donor site probably null
R1331:Loxhd1 UTSW 18 77,490,632 (GRCm39) missense possibly damaging 0.86
R1465:Loxhd1 UTSW 18 77,468,269 (GRCm39) splice site probably null
R1465:Loxhd1 UTSW 18 77,468,269 (GRCm39) splice site probably null
R1501:Loxhd1 UTSW 18 77,444,528 (GRCm39) missense probably damaging 1.00
R1640:Loxhd1 UTSW 18 77,490,259 (GRCm39) missense probably damaging 1.00
R1656:Loxhd1 UTSW 18 77,409,364 (GRCm39) missense possibly damaging 0.71
R1671:Loxhd1 UTSW 18 77,492,498 (GRCm39) missense probably damaging 1.00
R1725:Loxhd1 UTSW 18 77,380,937 (GRCm39) missense probably benign 0.32
R1735:Loxhd1 UTSW 18 77,492,585 (GRCm39) missense probably damaging 0.98
R1796:Loxhd1 UTSW 18 77,513,335 (GRCm39) missense possibly damaging 0.88
R1796:Loxhd1 UTSW 18 77,493,603 (GRCm39) missense probably damaging 0.96
R1800:Loxhd1 UTSW 18 77,490,198 (GRCm39) missense probably damaging 1.00
R1848:Loxhd1 UTSW 18 77,369,667 (GRCm39) missense possibly damaging 0.53
R1912:Loxhd1 UTSW 18 77,427,833 (GRCm39) missense probably benign 0.32
R1945:Loxhd1 UTSW 18 77,492,504 (GRCm39) missense probably damaging 1.00
R1978:Loxhd1 UTSW 18 77,409,338 (GRCm39) missense possibly damaging 0.86
R1997:Loxhd1 UTSW 18 77,383,465 (GRCm39) missense probably damaging 0.98
R2086:Loxhd1 UTSW 18 77,472,642 (GRCm39) missense probably damaging 1.00
R2153:Loxhd1 UTSW 18 77,443,862 (GRCm39) missense possibly damaging 0.72
R3124:Loxhd1 UTSW 18 77,518,774 (GRCm39) missense probably damaging 0.97
R3896:Loxhd1 UTSW 18 77,469,719 (GRCm39) missense possibly damaging 0.65
R3907:Loxhd1 UTSW 18 77,496,464 (GRCm39) missense possibly damaging 0.60
R3980:Loxhd1 UTSW 18 77,501,855 (GRCm39) missense probably damaging 1.00
R4165:Loxhd1 UTSW 18 77,460,025 (GRCm39) missense probably damaging 0.99
R4166:Loxhd1 UTSW 18 77,460,025 (GRCm39) missense probably damaging 0.99
R4176:Loxhd1 UTSW 18 77,418,755 (GRCm39) missense possibly damaging 0.53
R4345:Loxhd1 UTSW 18 77,486,697 (GRCm39) missense possibly damaging 0.89
R4354:Loxhd1 UTSW 18 77,483,123 (GRCm39) missense probably damaging 1.00
R4385:Loxhd1 UTSW 18 77,460,607 (GRCm39) missense probably damaging 0.99
R4402:Loxhd1 UTSW 18 77,529,456 (GRCm39) missense possibly damaging 0.94
R4404:Loxhd1 UTSW 18 77,518,828 (GRCm39) missense probably damaging 1.00
R4456:Loxhd1 UTSW 18 77,486,785 (GRCm39) missense probably damaging 1.00
R4525:Loxhd1 UTSW 18 77,444,608 (GRCm39) missense probably damaging 0.98
R4605:Loxhd1 UTSW 18 77,493,642 (GRCm39) missense probably benign 0.00
R4661:Loxhd1 UTSW 18 77,490,581 (GRCm39) missense possibly damaging 0.79
R4698:Loxhd1 UTSW 18 77,459,987 (GRCm39) missense possibly damaging 0.82
R4725:Loxhd1 UTSW 18 77,483,153 (GRCm39) missense probably damaging 1.00
R4820:Loxhd1 UTSW 18 77,472,663 (GRCm39) missense probably damaging 1.00
R5163:Loxhd1 UTSW 18 77,449,432 (GRCm39) missense possibly damaging 0.92
R5288:Loxhd1 UTSW 18 77,451,308 (GRCm39) missense probably damaging 1.00
R5328:Loxhd1 UTSW 18 77,498,268 (GRCm39) missense probably damaging 1.00
R5329:Loxhd1 UTSW 18 77,420,378 (GRCm39) missense probably damaging 0.98
R5347:Loxhd1 UTSW 18 77,454,237 (GRCm39) missense probably damaging 1.00
R5589:Loxhd1 UTSW 18 77,429,751 (GRCm39) missense possibly damaging 0.86
R5616:Loxhd1 UTSW 18 77,492,647 (GRCm39) missense probably damaging 1.00
R5703:Loxhd1 UTSW 18 77,444,573 (GRCm39) missense probably damaging 1.00
R5837:Loxhd1 UTSW 18 77,374,105 (GRCm39) missense possibly damaging 0.71
R5888:Loxhd1 UTSW 18 77,490,211 (GRCm39) missense probably damaging 0.99
R6021:Loxhd1 UTSW 18 77,499,946 (GRCm39) missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77,469,254 (GRCm39) missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77,469,254 (GRCm39) missense probably damaging 1.00
R6153:Loxhd1 UTSW 18 77,383,454 (GRCm39) missense possibly damaging 0.71
R6174:Loxhd1 UTSW 18 77,499,874 (GRCm39) missense probably damaging 1.00
R6265:Loxhd1 UTSW 18 77,449,426 (GRCm39) missense probably damaging 0.99
R6377:Loxhd1 UTSW 18 77,468,128 (GRCm39) missense probably damaging 1.00
R6530:Loxhd1 UTSW 18 77,499,847 (GRCm39) missense probably benign 0.30
R6555:Loxhd1 UTSW 18 77,380,965 (GRCm39) missense possibly damaging 0.51
R6782:Loxhd1 UTSW 18 77,518,873 (GRCm39) missense probably damaging 0.99
R6834:Loxhd1 UTSW 18 77,529,222 (GRCm39) missense probably damaging 1.00
R7000:Loxhd1 UTSW 18 77,460,129 (GRCm39) critical splice donor site probably null
R7112:Loxhd1 UTSW 18 77,476,210 (GRCm39) missense probably damaging 1.00
R7203:Loxhd1 UTSW 18 77,501,892 (GRCm39) missense probably damaging 0.97
R7206:Loxhd1 UTSW 18 77,529,513 (GRCm39) missense probably damaging 0.97
R7260:Loxhd1 UTSW 18 77,420,338 (GRCm39) missense possibly damaging 0.93
R7432:Loxhd1 UTSW 18 77,383,547 (GRCm39) missense possibly damaging 0.51
R7475:Loxhd1 UTSW 18 77,500,001 (GRCm39) missense possibly damaging 0.83
R7555:Loxhd1 UTSW 18 77,483,061 (GRCm39) missense probably damaging 0.99
R7590:Loxhd1 UTSW 18 77,409,330 (GRCm39) missense possibly damaging 0.84
R7612:Loxhd1 UTSW 18 77,517,671 (GRCm39) missense possibly damaging 0.95
R7626:Loxhd1 UTSW 18 77,518,882 (GRCm39) missense possibly damaging 0.75
R7768:Loxhd1 UTSW 18 77,472,637 (GRCm39) missense probably damaging 0.99
R7791:Loxhd1 UTSW 18 77,471,425 (GRCm39) missense probably damaging 1.00
R7829:Loxhd1 UTSW 18 77,496,483 (GRCm39) missense probably damaging 0.99
R7884:Loxhd1 UTSW 18 77,518,909 (GRCm39) missense probably damaging 0.98
R7960:Loxhd1 UTSW 18 77,472,746 (GRCm39) missense probably damaging 0.99
R7986:Loxhd1 UTSW 18 77,462,890 (GRCm39) missense possibly damaging 0.88
R8042:Loxhd1 UTSW 18 77,518,888 (GRCm39) missense probably damaging 0.99
R8084:Loxhd1 UTSW 18 77,427,845 (GRCm39) missense possibly damaging 0.71
R8088:Loxhd1 UTSW 18 77,429,709 (GRCm39) missense possibly damaging 0.52
R8100:Loxhd1 UTSW 18 77,492,512 (GRCm39) missense possibly damaging 0.69
R8139:Loxhd1 UTSW 18 77,468,192 (GRCm39) missense possibly damaging 0.95
R8152:Loxhd1 UTSW 18 77,476,095 (GRCm39) missense possibly damaging 0.62
R8199:Loxhd1 UTSW 18 77,469,334 (GRCm39) missense possibly damaging 0.77
R8246:Loxhd1 UTSW 18 77,451,242 (GRCm39) missense possibly damaging 0.71
R8263:Loxhd1 UTSW 18 77,462,858 (GRCm39) missense probably damaging 1.00
R8342:Loxhd1 UTSW 18 77,493,681 (GRCm39) missense possibly damaging 0.88
R8401:Loxhd1 UTSW 18 77,468,156 (GRCm39) missense probably damaging 1.00
R8480:Loxhd1 UTSW 18 77,518,827 (GRCm39) missense probably damaging 1.00
R8490:Loxhd1 UTSW 18 77,529,162 (GRCm39) missense possibly damaging 0.96
R8807:Loxhd1 UTSW 18 77,444,468 (GRCm39) missense possibly damaging 0.93
R8961:Loxhd1 UTSW 18 77,472,765 (GRCm39) missense probably damaging 1.00
R8974:Loxhd1 UTSW 18 77,518,899 (GRCm39) missense possibly damaging 0.88
R9079:Loxhd1 UTSW 18 77,490,593 (GRCm39) missense probably benign
R9284:Loxhd1 UTSW 18 77,501,826 (GRCm39) missense probably damaging 0.97
R9312:Loxhd1 UTSW 18 77,498,285 (GRCm39) missense probably benign 0.05
R9619:Loxhd1 UTSW 18 77,443,871 (GRCm39) missense probably benign 0.32
X0020:Loxhd1 UTSW 18 77,427,258 (GRCm39) nonsense probably null
X0024:Loxhd1 UTSW 18 77,483,099 (GRCm39) missense probably damaging 1.00
X0062:Loxhd1 UTSW 18 77,529,212 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACACAGGAGACATGTGCTG -3'
(R):5'- CTTAGTGGCTAAAGATGGACTGTG -3'

Sequencing Primer
(F):5'- ACATGTGCTGTCTGCCTCTATAGG -3'
(R):5'- TTTTAGCAGTAGACAAGCGCTGAC -3'
Posted On 2020-09-02