Incidental Mutation 'R8324:Ehbp1l1'
ID 644032
Institutional Source Beutler Lab
Gene Symbol Ehbp1l1
Ensembl Gene ENSMUSG00000024937
Gene Name EH domain binding protein 1-like 1
Synonyms G430002G23Rik
MMRRC Submission 067725-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 5757404-5776345 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 5770026 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 426 (V426F)
Ref Sequence ENSEMBL: ENSMUSP00000037656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049295] [ENSMUST00000075606]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000049295
AA Change: V426F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037656
Gene: ENSMUSG00000024937
AA Change: V426F

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.2e-24 PFAM
low complexity region 245 256 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
internal_repeat_1 442 821 1.71e-12 PROSPERO
internal_repeat_1 833 1197 1.71e-12 PROSPERO
CH 1212 1310 3.55e-16 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1426 1449 N/A INTRINSIC
low complexity region 1471 1484 N/A INTRINSIC
low complexity region 1493 1547 N/A INTRINSIC
DUF3585 1552 1696 6.7e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075606
SMART Domains Protein: ENSMUSP00000126740
Gene: ENSMUSG00000024937

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.9e-25 PFAM
CH 268 366 3.55e-16 SMART
low complexity region 372 387 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 603 N/A INTRINSIC
DUF3585 608 752 6.7e-59 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout leads to a reduction in the length and density of small intestinal microvilli, severe anemia, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,240,395 (GRCm39) S753P probably damaging Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Antxr2 T C 5: 98,086,368 (GRCm39) N413S probably damaging Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
Caprin1 G A 2: 103,613,526 (GRCm39) R79* probably null Het
Cdan1 A G 2: 120,557,806 (GRCm39) V507A probably benign Het
Cdkl3 T A 11: 51,913,706 (GRCm39) probably null Het
Chst5 A T 8: 112,617,140 (GRCm39) L160Q probably benign Het
Col11a1 C G 3: 113,958,059 (GRCm39) P1111R probably damaging Het
Col6a6 T A 9: 105,632,853 (GRCm39) E1470D probably benign Het
Cpped1 T A 16: 11,623,340 (GRCm39) T274S probably benign Het
Ctnnbl1 G A 2: 157,621,735 (GRCm39) E75K probably damaging Het
Cyp4f40 T C 17: 32,878,502 (GRCm39) S15P probably benign Het
Ddx46 T C 13: 55,811,727 (GRCm39) S643P probably damaging Het
Defb34 A G 8: 19,173,814 (GRCm39) Q16R probably null Het
Dhrs2 T A 14: 55,476,221 (GRCm39) V147E probably damaging Het
Dnah5 G T 15: 28,347,011 (GRCm39) R2498L probably damaging Het
Dpp10 T A 1: 123,781,901 (GRCm39) I93F probably benign Het
Eef1e1 T A 13: 38,839,045 (GRCm39) D104V probably damaging Het
Egfr A G 11: 16,808,971 (GRCm39) Y55C probably damaging Het
Egfr A C 11: 16,858,885 (GRCm39) I955L probably damaging Het
Elp1 C T 4: 56,772,491 (GRCm39) E877K probably damaging Het
Fam234a C T 17: 26,437,672 (GRCm39) V108I probably benign Het
Fzd8 T A 18: 9,214,688 (GRCm39) M590K probably damaging Het
Gm13287 T C 4: 88,721,875 (GRCm39) S129P probably damaging Het
Heatr5b A G 17: 79,062,793 (GRCm39) S1919P possibly damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itpr2 T C 6: 146,229,896 (GRCm39) E1233G probably damaging Het
Kcnmb4 A G 10: 116,254,219 (GRCm39) L186P probably damaging Het
Krt72 T A 15: 101,690,580 (GRCm39) Y224F probably damaging Het
Loxhd1 T C 18: 77,427,275 (GRCm39) probably null Het
Lrguk A G 6: 34,079,506 (GRCm39) T914A probably benign Het
Lrrtm4 A G 6: 79,998,974 (GRCm39) T129A probably damaging Het
Mmp13 A T 9: 7,276,636 (GRCm39) I244F possibly damaging Het
Mob1a T A 6: 83,306,956 (GRCm39) L41Q probably damaging Het
Mtcl1 T C 17: 66,743,212 (GRCm39) R426G probably damaging Het
Mybbp1a T C 11: 72,336,114 (GRCm39) probably null Het
Myh9 A G 15: 77,673,117 (GRCm39) probably null Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Ncapg T G 5: 45,853,010 (GRCm39) H825Q probably damaging Het
Olfml1 T C 7: 107,189,570 (GRCm39) S212P probably benign Het
Or52p1 G A 7: 104,267,321 (GRCm39) R145H probably benign Het
Pak2 T C 16: 31,871,029 (GRCm39) N51S probably benign Het
Papln T C 12: 83,833,393 (GRCm39) Y1132H probably damaging Het
Pax3 T A 1: 78,170,426 (GRCm39) R134S probably damaging Het
Pdzrn4 A G 15: 92,668,818 (GRCm39) E990G probably damaging Het
Peak1 A T 9: 56,114,760 (GRCm39) W1394R probably damaging Het
Pkn2 T C 3: 142,534,771 (GRCm39) N285D probably benign Het
Pramel13 A C 4: 144,122,427 (GRCm39) L39R probably damaging Het
Prrc2a A G 17: 35,375,960 (GRCm39) S897P possibly damaging Het
Rad51 A G 2: 118,954,312 (GRCm39) T131A possibly damaging Het
Rc3h2 T A 2: 37,290,738 (GRCm39) T255S possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rictor T A 15: 6,775,043 (GRCm39) V125E probably damaging Het
Rps6ka5 C T 12: 100,524,746 (GRCm39) D664N possibly damaging Het
Rreb1 T A 13: 38,131,597 (GRCm39) W1584R probably damaging Het
Rxra T C 2: 27,631,195 (GRCm39) I142T probably damaging Het
Sall2 T C 14: 52,550,343 (GRCm39) T951A probably benign Het
Slc15a2 T G 16: 36,579,669 (GRCm39) N359T probably damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc6a13 T C 6: 121,314,373 (GRCm39) *603Q probably null Het
Sptb T C 12: 76,665,936 (GRCm39) D894G possibly damaging Het
Srgn A G 10: 62,343,444 (GRCm39) L17P probably damaging Het
Tmprss9 T C 10: 80,733,205 (GRCm39) probably null Het
Trav9n-4 T C 14: 53,532,403 (GRCm39) F86L probably benign Het
Trp63 A G 16: 25,695,484 (GRCm39) Y482C unknown Het
Ttc9b G T 7: 27,353,394 (GRCm39) A15S probably damaging Het
Urb1 A T 16: 90,588,078 (GRCm39) I410N probably damaging Het
Vmn2r82 A T 10: 79,214,727 (GRCm39) K237* probably null Het
Wwox G A 8: 115,215,745 (GRCm39) probably null Het
Other mutations in Ehbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Ehbp1l1 APN 19 5,767,961 (GRCm39) missense probably benign 0.33
IGL01061:Ehbp1l1 APN 19 5,767,916 (GRCm39) missense probably benign
IGL01372:Ehbp1l1 APN 19 5,765,817 (GRCm39) splice site probably benign
IGL01790:Ehbp1l1 APN 19 5,773,012 (GRCm39) missense probably damaging 0.99
IGL01936:Ehbp1l1 APN 19 5,768,277 (GRCm39) nonsense probably null
IGL02194:Ehbp1l1 APN 19 5,768,885 (GRCm39) missense probably benign
IGL02347:Ehbp1l1 APN 19 5,769,600 (GRCm39) missense possibly damaging 0.72
IGL02372:Ehbp1l1 APN 19 5,760,862 (GRCm39) missense possibly damaging 0.53
IGL02681:Ehbp1l1 APN 19 5,770,853 (GRCm39) missense probably damaging 0.98
IGL02824:Ehbp1l1 APN 19 5,769,326 (GRCm39) missense probably benign
IGL03070:Ehbp1l1 APN 19 5,765,981 (GRCm39) missense probably benign 0.33
IGL03146:Ehbp1l1 APN 19 5,770,061 (GRCm39) missense probably benign 0.00
PIT4802001:Ehbp1l1 UTSW 19 5,769,603 (GRCm39) missense possibly damaging 0.93
R0309:Ehbp1l1 UTSW 19 5,770,598 (GRCm39) missense possibly damaging 0.72
R0787:Ehbp1l1 UTSW 19 5,772,696 (GRCm39) missense possibly damaging 0.95
R1156:Ehbp1l1 UTSW 19 5,758,364 (GRCm39) unclassified probably benign
R1337:Ehbp1l1 UTSW 19 5,768,258 (GRCm39) missense probably benign 0.00
R1474:Ehbp1l1 UTSW 19 5,769,112 (GRCm39) missense possibly damaging 0.86
R1501:Ehbp1l1 UTSW 19 5,766,452 (GRCm39) missense probably damaging 0.98
R1582:Ehbp1l1 UTSW 19 5,771,995 (GRCm39) missense possibly damaging 0.83
R1766:Ehbp1l1 UTSW 19 5,766,434 (GRCm39) missense probably damaging 0.98
R1838:Ehbp1l1 UTSW 19 5,767,719 (GRCm39) missense probably benign 0.39
R1842:Ehbp1l1 UTSW 19 5,775,958 (GRCm39) missense probably damaging 0.99
R1863:Ehbp1l1 UTSW 19 5,767,882 (GRCm39) missense probably benign 0.01
R1955:Ehbp1l1 UTSW 19 5,760,697 (GRCm39) missense possibly damaging 0.51
R2010:Ehbp1l1 UTSW 19 5,769,311 (GRCm39) missense probably benign
R2098:Ehbp1l1 UTSW 19 5,758,686 (GRCm39) missense possibly damaging 0.93
R2099:Ehbp1l1 UTSW 19 5,768,429 (GRCm39) missense possibly damaging 0.72
R2852:Ehbp1l1 UTSW 19 5,766,515 (GRCm39) missense probably damaging 0.99
R3113:Ehbp1l1 UTSW 19 5,769,008 (GRCm39) missense probably benign 0.38
R3799:Ehbp1l1 UTSW 19 5,769,143 (GRCm39) missense probably benign 0.33
R3891:Ehbp1l1 UTSW 19 5,768,340 (GRCm39) missense possibly damaging 0.73
R3964:Ehbp1l1 UTSW 19 5,760,601 (GRCm39) critical splice donor site probably null
R3966:Ehbp1l1 UTSW 19 5,760,601 (GRCm39) critical splice donor site probably null
R4335:Ehbp1l1 UTSW 19 5,758,797 (GRCm39) missense probably damaging 0.98
R4434:Ehbp1l1 UTSW 19 5,766,276 (GRCm39) missense possibly damaging 0.93
R4457:Ehbp1l1 UTSW 19 5,766,321 (GRCm39) missense possibly damaging 0.83
R4597:Ehbp1l1 UTSW 19 5,767,955 (GRCm39) missense possibly damaging 0.72
R4726:Ehbp1l1 UTSW 19 5,769,204 (GRCm39) missense possibly damaging 0.70
R4761:Ehbp1l1 UTSW 19 5,769,875 (GRCm39) missense possibly damaging 0.93
R4771:Ehbp1l1 UTSW 19 5,775,996 (GRCm39) missense probably damaging 1.00
R5402:Ehbp1l1 UTSW 19 5,766,348 (GRCm39) missense possibly damaging 0.91
R5436:Ehbp1l1 UTSW 19 5,766,276 (GRCm39) missense possibly damaging 0.93
R5602:Ehbp1l1 UTSW 19 5,758,698 (GRCm39) missense possibly damaging 0.85
R5893:Ehbp1l1 UTSW 19 5,768,459 (GRCm39) missense probably benign
R6329:Ehbp1l1 UTSW 19 5,768,795 (GRCm39) missense possibly damaging 0.53
R6416:Ehbp1l1 UTSW 19 5,768,785 (GRCm39) missense probably benign 0.01
R7106:Ehbp1l1 UTSW 19 5,768,765 (GRCm39) missense probably benign 0.33
R7262:Ehbp1l1 UTSW 19 5,768,474 (GRCm39) nonsense probably null
R7304:Ehbp1l1 UTSW 19 5,766,410 (GRCm39) missense probably damaging 1.00
R7317:Ehbp1l1 UTSW 19 5,770,730 (GRCm39) missense probably benign 0.44
R7404:Ehbp1l1 UTSW 19 5,770,872 (GRCm39) missense possibly damaging 0.72
R7447:Ehbp1l1 UTSW 19 5,769,456 (GRCm39) missense possibly damaging 0.53
R7862:Ehbp1l1 UTSW 19 5,770,851 (GRCm39) missense probably benign
R7881:Ehbp1l1 UTSW 19 5,769,426 (GRCm39) missense probably benign
R7910:Ehbp1l1 UTSW 19 5,766,452 (GRCm39) missense probably benign 0.28
R8239:Ehbp1l1 UTSW 19 5,770,089 (GRCm39) missense possibly damaging 0.53
R8309:Ehbp1l1 UTSW 19 5,767,103 (GRCm39) missense probably damaging 1.00
R8724:Ehbp1l1 UTSW 19 5,765,886 (GRCm39) missense possibly damaging 0.73
R9260:Ehbp1l1 UTSW 19 5,769,278 (GRCm39) missense probably benign 0.07
R9453:Ehbp1l1 UTSW 19 5,758,371 (GRCm39) missense unknown
RF053:Ehbp1l1 UTSW 19 5,766,030 (GRCm39) small deletion probably benign
Z1088:Ehbp1l1 UTSW 19 5,766,315 (GRCm39) missense possibly damaging 0.77
Z1176:Ehbp1l1 UTSW 19 5,767,917 (GRCm39) missense probably benign
Z1177:Ehbp1l1 UTSW 19 5,769,462 (GRCm39) missense probably benign 0.02
Z1177:Ehbp1l1 UTSW 19 5,769,130 (GRCm39) missense probably benign 0.01
Z1177:Ehbp1l1 UTSW 19 5,769,129 (GRCm39) missense probably benign 0.07
Z1177:Ehbp1l1 UTSW 19 5,768,790 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTTCAGGCTCAGCTGGAG -3'
(R):5'- GCTCAGATAAGCTCTCAGGAAG -3'

Sequencing Primer
(F):5'- CTGGAGGTGGGTTCAGGTCAC -3'
(R):5'- GTCAGAGGCTCCAAAGATTCTCTG -3'
Posted On 2020-09-02