Mutagenetix > Incidental Mutation

Incidental Mutation 'R8324:Ehbp1l1'

644032

Institutional Source

Beutler Lab

Gene Symbol

Ehbp1l1

Ensembl Gene

ENSMUSG00000024937

Gene Name

EH domain binding protein 1-like 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8324 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

5707376-5726317 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 5719998 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 426 (V426F)

Ref Sequence

ENSEMBL: ENSMUSP00000037656 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049295] [ENSMUST00000075606]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049295
AA Change: V426F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000037656
Gene: ENSMUSG00000024937
AA Change: V426F

Domain	Start	End	E-Value	Type
Pfam:NT-C2	12	164	3.2e-24	PFAM
low complexity region	245	256	N/A	INTRINSIC
low complexity region	276	291	N/A	INTRINSIC
internal_repeat_1	442	821	1.71e-12	PROSPERO
internal_repeat_1	833	1197	1.71e-12	PROSPERO
CH	1212	1310	3.55e-16	SMART
low complexity region	1316	1331	N/A	INTRINSIC
low complexity region	1426	1449	N/A	INTRINSIC
low complexity region	1471	1484	N/A	INTRINSIC
low complexity region	1493	1547	N/A	INTRINSIC
DUF3585	1552	1696	6.7e-59	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000075606

SMART Domains

Protein: ENSMUSP00000126740
Gene: ENSMUSG00000024937

Domain	Start	End	E-Value	Type
Pfam:NT-C2	12	164	3.9e-25	PFAM
CH	268	366	3.55e-16	SMART
low complexity region	372	387	N/A	INTRINSIC
low complexity region	482	505	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
low complexity region	549	603	N/A	INTRINSIC
DUF3585	608	752	6.7e-59	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous knockout leads to a reduction in the length and density of small intestinal microvilli, severe anemia, and neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,290,395	S753P	probably damaging	Het
Acan	A	G	7: 79,091,056	E390G	probably damaging	Het
Antxr2	T	C	5: 97,938,509	N413S	probably damaging	Het
Bace2	C	T	16: 97,356,908	A36V	possibly damaging	Het
Caprin1	G	A	2: 103,783,181	R79*	probably null	Het
Cdan1	A	G	2: 120,727,325	V507A	probably benign	Het
Cdkl3	T	A	11: 52,022,879		probably null	Het
Chst5	A	T	8: 111,890,508	L160Q	probably benign	Het
Col11a1	C	G	3: 114,164,410	P1111R	probably damaging	Het
Col6a6	T	A	9: 105,755,654	E1470D	probably benign	Het
Cpped1	T	A	16: 11,805,476	T274S	probably benign	Het
Ctnnbl1	G	A	2: 157,779,815	E75K	probably damaging	Het
Cyp4f40	T	C	17: 32,659,528	S15P	probably benign	Het
Ddx46	T	C	13: 55,663,914	S643P	probably damaging	Het
Defb34	A	G	8: 19,123,798	Q16R	probably null	Het
Dhrs2	T	A	14: 55,238,764	V147E	probably damaging	Het
Dnah5	G	T	15: 28,346,865	R2498L	probably damaging	Het
Dpp10	T	A	1: 123,854,172	I93F	probably benign	Het
Eef1e1	T	A	13: 38,655,069	D104V	probably damaging	Het
Egfr	A	G	11: 16,858,971	Y55C	probably damaging	Het
Egfr	A	C	11: 16,908,885	I955L	probably damaging	Het
Fam234a	C	T	17: 26,218,698	V108I	probably benign	Het
Fzd8	T	A	18: 9,214,688	M590K	probably damaging	Het
Gm13287	T	C	4: 88,803,638	S129P	probably damaging	Het
Heatr5b	A	G	17: 78,755,364	S1919P	possibly damaging	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Ikbkap	C	T	4: 56,772,491	E877K	probably damaging	Het
Itpr2	T	C	6: 146,328,398	E1233G	probably damaging	Het
Kcnmb4	A	G	10: 116,418,314	L186P	probably damaging	Het
Krt72	T	A	15: 101,782,145	Y224F	probably damaging	Het
Loxhd1	T	C	18: 77,339,579		probably null	Het
Lrguk	A	G	6: 34,102,571	T914A	probably benign	Het
Lrrtm4	A	G	6: 80,021,991	T129A	probably damaging	Het
Mmp13	A	T	9: 7,276,636	I244F	possibly damaging	Het
Mob1a	T	A	6: 83,329,974	L41Q	probably damaging	Het
Mtcl1	T	C	17: 66,436,217	R426G	probably damaging	Het
Mybbp1a	T	C	11: 72,445,288		probably null	Het
Myh9	A	G	15: 77,788,917		probably null	Het
Myo1d	T	A	11: 80,557,521	D926V	probably damaging	Het
Ncapg	T	G	5: 45,695,668	H825Q	probably damaging	Het
Olfml1	T	C	7: 107,590,363	S212P	probably benign	Het
Olfr656	G	A	7: 104,618,114	R145H	probably benign	Het
Pak2	T	C	16: 32,052,211	N51S	probably benign	Het
Papln	T	C	12: 83,786,619	Y1132H	probably damaging	Het
Pax3	T	A	1: 78,193,789	R134S	probably damaging	Het
Pdzrn4	A	G	15: 92,770,937	E990G	probably damaging	Het
Peak1	A	T	9: 56,207,476	W1394R	probably damaging	Het
Pkn2	T	C	3: 142,829,010	N285D	probably benign	Het
Pramef12	A	C	4: 144,395,857	L39R	probably damaging	Het
Prrc2a	A	G	17: 35,156,984	S897P	possibly damaging	Het
Rad51	A	G	2: 119,123,831	T131A	possibly damaging	Het
Rc3h2	T	A	2: 37,400,726	T255S	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rictor	T	A	15: 6,745,562	V125E	probably damaging	Het
Rps6ka5	C	T	12: 100,558,487	D664N	possibly damaging	Het
Rreb1	T	A	13: 37,947,621	W1584R	probably damaging	Het
Rxra	T	C	2: 27,741,183	I142T	probably damaging	Het
Sall2	T	C	14: 52,312,886	T951A	probably benign	Het
Slc15a2	T	G	16: 36,759,307	N359T	probably damaging	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Slc6a13	T	C	6: 121,337,414	*603Q	probably null	Het
Sptb	T	C	12: 76,619,162	D894G	possibly damaging	Het
Srgn	A	G	10: 62,507,665	L17P	probably damaging	Het
Tmprss9	T	C	10: 80,897,371		probably null	Het
Trav9n-4	T	C	14: 53,294,946	F86L	probably benign	Het
Trp63	A	G	16: 25,876,734	Y482C	unknown	Het
Ttc9b	G	T	7: 27,653,969	A15S	probably damaging	Het
Urb1	A	T	16: 90,791,190	I410N	probably damaging	Het
Vmn2r82	A	T	10: 79,378,893	K237*	probably null	Het
Wwox	G	A	8: 114,489,005		probably null	Het

Other mutations in Ehbp1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Ehbp1l1	APN	19	5717933	missense	probably benign	0.33
IGL01061:Ehbp1l1	APN	19	5717888	missense	probably benign
IGL01372:Ehbp1l1	APN	19	5715789	splice site	probably benign
IGL01790:Ehbp1l1	APN	19	5722984	missense	probably damaging	0.99
IGL01936:Ehbp1l1	APN	19	5718249	nonsense	probably null
IGL02194:Ehbp1l1	APN	19	5718857	missense	probably benign
IGL02347:Ehbp1l1	APN	19	5719572	missense	possibly damaging	0.72
IGL02372:Ehbp1l1	APN	19	5710834	missense	possibly damaging	0.53
IGL02681:Ehbp1l1	APN	19	5720825	missense	probably damaging	0.98
IGL02824:Ehbp1l1	APN	19	5719298	missense	probably benign
IGL03070:Ehbp1l1	APN	19	5715953	missense	probably benign	0.33
IGL03146:Ehbp1l1	APN	19	5720033	missense	probably benign	0.00
PIT4802001:Ehbp1l1	UTSW	19	5719575	missense	possibly damaging	0.93
R0309:Ehbp1l1	UTSW	19	5720570	missense	possibly damaging	0.72
R0787:Ehbp1l1	UTSW	19	5722668	missense	possibly damaging	0.95
R1156:Ehbp1l1	UTSW	19	5708336	unclassified	probably benign
R1337:Ehbp1l1	UTSW	19	5718230	missense	probably benign	0.00
R1474:Ehbp1l1	UTSW	19	5719084	missense	possibly damaging	0.86
R1501:Ehbp1l1	UTSW	19	5716424	missense	probably damaging	0.98
R1582:Ehbp1l1	UTSW	19	5721967	missense	possibly damaging	0.83
R1766:Ehbp1l1	UTSW	19	5716406	missense	probably damaging	0.98
R1838:Ehbp1l1	UTSW	19	5717691	missense	probably benign	0.39
R1842:Ehbp1l1	UTSW	19	5725930	missense	probably damaging	0.99
R1863:Ehbp1l1	UTSW	19	5717854	missense	probably benign	0.01
R1955:Ehbp1l1	UTSW	19	5710669	missense	possibly damaging	0.51
R2010:Ehbp1l1	UTSW	19	5719283	missense	probably benign
R2098:Ehbp1l1	UTSW	19	5708658	missense	possibly damaging	0.93
R2099:Ehbp1l1	UTSW	19	5718401	missense	possibly damaging	0.72
R2852:Ehbp1l1	UTSW	19	5716487	missense	probably damaging	0.99
R3113:Ehbp1l1	UTSW	19	5718980	missense	probably benign	0.38
R3799:Ehbp1l1	UTSW	19	5719115	missense	probably benign	0.33
R3891:Ehbp1l1	UTSW	19	5718312	missense	possibly damaging	0.73
R3964:Ehbp1l1	UTSW	19	5710573	critical splice donor site	probably null
R3966:Ehbp1l1	UTSW	19	5710573	critical splice donor site	probably null
R4335:Ehbp1l1	UTSW	19	5708769	missense	probably damaging	0.98
R4434:Ehbp1l1	UTSW	19	5716248	missense	possibly damaging	0.93
R4457:Ehbp1l1	UTSW	19	5716293	missense	possibly damaging	0.83
R4597:Ehbp1l1	UTSW	19	5717927	missense	possibly damaging	0.72
R4726:Ehbp1l1	UTSW	19	5719176	missense	possibly damaging	0.70
R4761:Ehbp1l1	UTSW	19	5719847	missense	possibly damaging	0.93
R4771:Ehbp1l1	UTSW	19	5725968	missense	probably damaging	1.00
R5402:Ehbp1l1	UTSW	19	5716320	missense	possibly damaging	0.91
R5436:Ehbp1l1	UTSW	19	5716248	missense	possibly damaging	0.93
R5602:Ehbp1l1	UTSW	19	5708670	missense	possibly damaging	0.85
R5893:Ehbp1l1	UTSW	19	5718431	missense	probably benign
R6329:Ehbp1l1	UTSW	19	5718767	missense	possibly damaging	0.53
R6416:Ehbp1l1	UTSW	19	5718757	missense	probably benign	0.01
R7106:Ehbp1l1	UTSW	19	5718737	missense	probably benign	0.33
R7262:Ehbp1l1	UTSW	19	5718446	nonsense	probably null
R7304:Ehbp1l1	UTSW	19	5716382	missense	probably damaging	1.00
R7317:Ehbp1l1	UTSW	19	5720702	missense	probably benign	0.44
R7404:Ehbp1l1	UTSW	19	5720844	missense	possibly damaging	0.72
R7447:Ehbp1l1	UTSW	19	5719428	missense	possibly damaging	0.53
R7862:Ehbp1l1	UTSW	19	5720823	missense	probably benign
R7881:Ehbp1l1	UTSW	19	5719398	missense	probably benign
R7910:Ehbp1l1	UTSW	19	5716424	missense	probably benign	0.28
R8239:Ehbp1l1	UTSW	19	5720061	missense	possibly damaging	0.53
R8309:Ehbp1l1	UTSW	19	5717075	missense	probably damaging	1.00
R8724:Ehbp1l1	UTSW	19	5715858	missense	possibly damaging	0.73
R9260:Ehbp1l1	UTSW	19	5719250	missense	probably benign	0.07
R9453:Ehbp1l1	UTSW	19	5708343	missense	unknown
RF053:Ehbp1l1	UTSW	19	5716002	small deletion	probably benign
Z1088:Ehbp1l1	UTSW	19	5716287	missense	possibly damaging	0.77
Z1176:Ehbp1l1	UTSW	19	5717889	missense	probably benign
Z1177:Ehbp1l1	UTSW	19	5718762	missense	probably damaging	0.99
Z1177:Ehbp1l1	UTSW	19	5719101	missense	probably benign	0.07
Z1177:Ehbp1l1	UTSW	19	5719102	missense	probably benign	0.01
Z1177:Ehbp1l1	UTSW	19	5719434	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TTCTTCAGGCTCAGCTGGAG -3'
(R):5'- GCTCAGATAAGCTCTCAGGAAG -3'

Sequencing Primer
(F):5'- CTGGAGGTGGGTTCAGGTCAC -3'
(R):5'- GTCAGAGGCTCCAAAGATTCTCTG -3'

Posted On

2020-09-02