Incidental Mutation 'R8325:Emc1'
ID644039
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene NameER membrane protein complex subunit 1
SynonymsC230096C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R8325 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location139352587-139378730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139365210 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 487 (M487K)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
Predicted Effect probably benign
Transcript: ENSMUST00000042096
AA Change: M484K

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: M484K

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082262
AA Change: M487K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: M487K

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect probably benign
Transcript: ENSMUST00000179784
AA Change: M487K

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: M487K

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acr T C 15: 89,569,751 V97A probably benign Het
Agrn C T 4: 156,173,662 G1081D probably benign Het
Ang2 A G 14: 51,195,503 S141P probably damaging Het
Ap3b2 T C 7: 81,484,489 probably null Het
Apba2 A T 7: 64,695,982 T307S probably benign Het
AU019823 T C 9: 50,610,308 I104M probably benign Het
Cadm2 T A 16: 66,815,450 N84Y possibly damaging Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Ccdc62 T C 5: 123,954,385 C478R probably benign Het
Cep290 A C 10: 100,517,808 H801P probably benign Het
Chfr T A 5: 110,162,763 Y555* probably null Het
Cmas T C 6: 142,771,339 probably null Het
Cmtm7 T C 9: 114,763,347 I61V probably benign Het
Cyb5d2 A G 11: 72,778,825 S236P possibly damaging Het
Dcp1b C T 6: 119,215,436 Q438* probably null Het
Dgcr8 T C 16: 18,258,285 Q678R probably damaging Het
Gm7361 T C 5: 26,262,156 S258P probably damaging Het
Hbs1l A G 10: 21,307,649 I96M probably benign Het
Ifi27l2a G A 12: 103,442,885 A49V unknown Het
Igkv10-96 T C 6: 68,632,104 Y69C possibly damaging Het
Igsf10 A T 3: 59,318,533 V2573D probably damaging Het
Kcng3 T C 17: 83,631,578 N14S possibly damaging Het
Kif20a A G 18: 34,626,922 T94A possibly damaging Het
Lcp2 T A 11: 34,082,394 V324E probably benign Het
Lmod3 T C 6: 97,247,418 K481E probably benign Het
Met A G 6: 17,571,672 E1330G probably damaging Het
Mroh1 GCCCAGGCCCC GCC 15: 76,432,215 probably null Het
Mss51 T C 14: 20,484,703 D333G possibly damaging Het
Nav3 A G 10: 109,705,603 V1933A probably benign Het
Nbas A G 12: 13,288,795 Y212C probably damaging Het
Npsr1 C T 9: 24,286,822 probably benign Het
Nt5e A G 9: 88,363,562 E295G probably benign Het
Olfr1160 A T 2: 88,006,193 L186Q probably damaging Het
Olfr449 T C 6: 42,838,190 F103S probably damaging Het
Papss1 A G 3: 131,582,611 T136A probably benign Het
Pcdha1 A T 18: 36,930,814 D177V possibly damaging Het
Pcolce2 A T 9: 95,692,920 S308C probably damaging Het
Pdhx G T 2: 103,042,252 P162T probably benign Het
Plin3 C T 17: 56,286,268 R98Q probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rnf213 A G 11: 119,430,445 N1243S Het
Serpinb1b A T 13: 33,093,601 K272N probably benign Het
Sez6l A T 5: 112,428,116 probably null Het
Syne1 A T 10: 5,146,257 M739K probably benign Het
Tbc1d9 G A 8: 83,240,038 probably null Het
Trp53inp1 A G 4: 11,164,561 D35G probably damaging Het
Trpc7 A G 13: 56,804,711 V549A probably damaging Het
Usp18 T C 6: 121,253,810 L66S probably damaging Het
Vmn1r238 C T 18: 3,122,529 S295N probably benign Het
Vmn2r29 T C 7: 7,241,942 D311G probably damaging Het
Vmn2r91 C A 17: 18,136,363 A764D probably damaging Het
Wdfy4 T A 14: 32,967,487 I3031F Het
Wdr7 A G 18: 63,778,464 probably null Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7699:Emc1 UTSW 4 139354870 missense probably benign
R7715:Emc1 UTSW 4 139371623 missense probably damaging 1.00
R7984:Emc1 UTSW 4 139375449 missense probably damaging 1.00
R8112:Emc1 UTSW 4 139367187 missense probably benign 0.00
R8387:Emc1 UTSW 4 139361289 missense probably benign
R8751:Emc1 UTSW 4 139369968 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GATTCTAGGTAGGTGAAGTCCTAG -3'
(R):5'- AGGCTGTTACCGTCACCATC -3'

Sequencing Primer
(F):5'- TAGGTGAAGTCCTAGGAGCC -3'
(R):5'- ACCATCATTTTCTGCAGGTTGAAC -3'
Posted On2020-09-02