Incidental Mutation 'R8325:Met'
ID644044
Institutional Source Beutler Lab
Gene Symbol Met
Ensembl Gene ENSMUSG00000009376
Gene Namemet proto-oncogene
SynonymsPar4, HGF receptor, c-Met
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8325 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location17463800-17573980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17571672 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1330 (E1330G)
Ref Sequence ENSEMBL: ENSMUSP00000079324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443]
Predicted Effect probably damaging
Transcript: ENSMUST00000080469
AA Change: E1330G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: E1330G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115442
AA Change: E1330G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: E1330G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115443
AA Change: E1330G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: E1330G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acr T C 15: 89,569,751 V97A probably benign Het
Agrn C T 4: 156,173,662 G1081D probably benign Het
Ang2 A G 14: 51,195,503 S141P probably damaging Het
Apba2 A T 7: 64,695,982 T307S probably benign Het
AU019823 T C 9: 50,610,308 I104M probably benign Het
Cadm2 T A 16: 66,815,450 N84Y possibly damaging Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Ccdc62 T C 5: 123,954,385 C478R probably benign Het
Cep290 A C 10: 100,517,808 H801P probably benign Het
Chfr T A 5: 110,162,763 Y555* probably null Het
Cmas T C 6: 142,771,339 probably null Het
Cmtm7 T C 9: 114,763,347 I61V probably benign Het
Cyb5d2 A G 11: 72,778,825 S236P possibly damaging Het
Dcp1b C T 6: 119,215,436 Q438* probably null Het
Dgcr8 T C 16: 18,258,285 Q678R probably damaging Het
Emc1 T A 4: 139,365,210 M487K possibly damaging Het
Gm7361 T C 5: 26,262,156 S258P probably damaging Het
Hbs1l A G 10: 21,307,649 I96M probably benign Het
Ifi27l2a G A 12: 103,442,885 A49V unknown Het
Igkv10-96 T C 6: 68,632,104 Y69C possibly damaging Het
Igsf10 A T 3: 59,318,533 V2573D probably damaging Het
Kif20a A G 18: 34,626,922 T94A possibly damaging Het
Lcp2 T A 11: 34,082,394 V324E probably benign Het
Lmod3 T C 6: 97,247,418 K481E probably benign Het
Mroh1 GCCCAGGCCCC GCC 15: 76,432,215 probably null Het
Mss51 T C 14: 20,484,703 D333G possibly damaging Het
Nav3 A G 10: 109,705,603 V1933A probably benign Het
Nbas A G 12: 13,288,795 Y212C probably damaging Het
Npsr1 C T 9: 24,286,822 probably benign Het
Nt5e A G 9: 88,363,562 E295G probably benign Het
Olfr1160 A T 2: 88,006,193 L186Q probably damaging Het
Olfr449 T C 6: 42,838,190 F103S probably damaging Het
Papss1 A G 3: 131,582,611 T136A probably benign Het
Pcdha1 A T 18: 36,930,814 D177V possibly damaging Het
Pcolce2 A T 9: 95,692,920 S308C probably damaging Het
Pdhx G T 2: 103,042,252 P162T probably benign Het
Plin3 C T 17: 56,286,268 R98Q probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rnf213 A G 11: 119,430,445 N1243S Het
Serpinb1b A T 13: 33,093,601 K272N probably benign Het
Syne1 A T 10: 5,146,257 M739K probably benign Het
Tbc1d9 G A 8: 83,240,038 probably null Het
Trp53inp1 A G 4: 11,164,561 D35G probably damaging Het
Trpc7 A G 13: 56,804,711 V549A probably damaging Het
Usp18 T C 6: 121,253,810 L66S probably damaging Het
Vmn1r238 C T 18: 3,122,529 S295N probably benign Het
Vmn2r29 T C 7: 7,241,942 D311G probably damaging Het
Vmn2r91 C A 17: 18,136,363 A764D probably damaging Het
Wdfy4 T A 14: 32,967,487 I3031F Het
Other mutations in Met
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Met APN 6 17534937 unclassified probably benign
IGL01066:Met APN 6 17535105 critical splice donor site probably null
IGL01344:Met APN 6 17547032 missense probably benign 0.44
IGL01413:Met APN 6 17558896 splice site probably benign
IGL01608:Met APN 6 17558730 missense probably damaging 1.00
IGL01613:Met APN 6 17540577 missense probably damaging 1.00
IGL01820:Met APN 6 17534231 missense possibly damaging 0.89
IGL01843:Met APN 6 17491701 missense probably damaging 1.00
IGL02014:Met APN 6 17527257 splice site probably benign
IGL02027:Met APN 6 17563727 splice site probably benign
IGL02243:Met APN 6 17549094 missense probably damaging 1.00
IGL02373:Met APN 6 17491529 missense probably damaging 1.00
IGL02616:Met APN 6 17553347 missense probably damaging 1.00
IGL02702:Met APN 6 17534143 missense possibly damaging 0.92
IGL02704:Met APN 6 17491257 missense possibly damaging 0.62
IGL02714:Met APN 6 17491852 nonsense probably null
IGL02936:Met APN 6 17553397 missense probably damaging 1.00
IGL02943:Met APN 6 17535929 missense possibly damaging 0.84
IGL03057:Met APN 6 17558766 missense probably damaging 1.00
IGL03124:Met APN 6 17492078 missense probably benign 0.27
IGL03171:Met APN 6 17562273 splice site probably benign
IGL03266:Met APN 6 17540538 missense possibly damaging 0.61
IGL03285:Met APN 6 17553337 missense probably damaging 0.98
R0453:Met UTSW 6 17534198 missense possibly damaging 0.88
R0543:Met UTSW 6 17491970 missense probably damaging 1.00
R0601:Met UTSW 6 17555632 splice site probably null
R0652:Met UTSW 6 17491710 missense probably benign 0.00
R0941:Met UTSW 6 17491394 missense probably damaging 1.00
R1142:Met UTSW 6 17527183 nonsense probably null
R1553:Met UTSW 6 17491461 missense probably benign 0.01
R1569:Met UTSW 6 17531504 nonsense probably null
R1744:Met UTSW 6 17540646 missense possibly damaging 0.47
R2224:Met UTSW 6 17563722 splice site probably null
R2308:Met UTSW 6 17491742 missense probably benign 0.00
R2369:Met UTSW 6 17531528 missense probably benign 0.04
R2393:Met UTSW 6 17534198 missense probably damaging 0.99
R2419:Met UTSW 6 17535830 splice site probably benign
R2483:Met UTSW 6 17549086 missense probably damaging 1.00
R2511:Met UTSW 6 17491967 missense probably damaging 1.00
R3622:Met UTSW 6 17549086 missense probably damaging 1.00
R3623:Met UTSW 6 17549086 missense probably damaging 1.00
R3624:Met UTSW 6 17549086 missense probably damaging 1.00
R4050:Met UTSW 6 17533984 missense probably benign
R4051:Met UTSW 6 17548729 missense possibly damaging 0.86
R4159:Met UTSW 6 17562272 splice site probably null
R4208:Met UTSW 6 17548729 missense possibly damaging 0.86
R4622:Met UTSW 6 17513384 missense probably benign 0.19
R4672:Met UTSW 6 17571804 missense probably benign 0.33
R4737:Met UTSW 6 17491541 missense probably damaging 1.00
R4738:Met UTSW 6 17491541 missense probably damaging 1.00
R4834:Met UTSW 6 17491413 missense probably damaging 0.97
R4846:Met UTSW 6 17491929 missense probably damaging 0.99
R4855:Met UTSW 6 17558797 missense probably damaging 1.00
R4878:Met UTSW 6 17549059 missense probably damaging 1.00
R4902:Met UTSW 6 17546996 missense probably damaging 1.00
R5208:Met UTSW 6 17526423 nonsense probably null
R5355:Met UTSW 6 17491362 missense probably damaging 1.00
R5415:Met UTSW 6 17527085 missense probably benign 0.01
R5556:Met UTSW 6 17534176 missense probably benign 0.04
R5590:Met UTSW 6 17548782 missense probably benign 0.00
R5683:Met UTSW 6 17571744 missense probably damaging 1.00
R5872:Met UTSW 6 17562198 missense probably damaging 1.00
R5891:Met UTSW 6 17491539 missense probably benign 0.02
R5895:Met UTSW 6 17531582 missense probably benign 0.02
R6063:Met UTSW 6 17491968 missense probably damaging 1.00
R6262:Met UTSW 6 17553404 missense probably benign 0.00
R6362:Met UTSW 6 17558733 missense probably damaging 1.00
R6747:Met UTSW 6 17571467 missense probably damaging 1.00
R6966:Met UTSW 6 17531532 missense possibly damaging 0.65
R6989:Met UTSW 6 17535928 missense possibly damaging 0.67
R6989:Met UTSW 6 17535929 missense probably damaging 1.00
R7017:Met UTSW 6 17491287 nonsense probably null
R7037:Met UTSW 6 17547128 intron probably benign
R7141:Met UTSW 6 17527155 missense probably benign 0.01
R7242:Met UTSW 6 17491317 missense probably damaging 1.00
R7282:Met UTSW 6 17547012 nonsense probably null
R7624:Met UTSW 6 17558835 missense probably damaging 1.00
R7770:Met UTSW 6 17491407 missense possibly damaging 0.79
R7797:Met UTSW 6 17533953 missense probably damaging 1.00
R8082:Met UTSW 6 17492313 missense probably damaging 0.98
R8109:Met UTSW 6 17562237 missense probably damaging 1.00
R8162:Met UTSW 6 17547062 missense probably damaging 0.98
R8315:Met UTSW 6 17533957 missense probably damaging 0.99
R8348:Met UTSW 6 17571800 missense probably benign 0.00
R8354:Met UTSW 6 17491769 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGGCAGAAGACTCTTGC -3'
(R):5'- CCAGAACTGTTTCTTGGAAGTGG -3'

Sequencing Primer
(F):5'- GAATACTGTCCAGACGCCTTGTAAG -3'
(R):5'- GGCTGGTGGACCTCTCATTC -3'
Posted On2020-09-02