Incidental Mutation 'R8325:Nt5e'
ID644058
Institutional Source Beutler Lab
Gene Symbol Nt5e
Ensembl Gene ENSMUSG00000032420
Gene Name5' nucleotidase, ecto
Synonymsecto-5'-nucleotidase, CD73, Nt5, 2210401F01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8325 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location88327197-88372092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88363562 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 295 (E295G)
Ref Sequence ENSEMBL: ENSMUSP00000034992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034992]
Predicted Effect probably benign
Transcript: ENSMUST00000034992
AA Change: E295G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034992
Gene: ENSMUSG00000032420
AA Change: E295G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Metallophos 31 248 2.1e-15 PFAM
Pfam:5_nucleotid_C 340 515 4.9e-45 PFAM
transmembrane domain 553 575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a membrane-bound nucleotidase that hydrolyzes extracellular nucleoside monophosphates. The encoded preproprotein undergoes proteolytic processing to generate to a functional, homodimeric enzyme that preferentially uses adenosine monophosphate as a substrate to generate free adenosine. Mice lacking the encoded protein exhibit a significantly reduced fall in stop flow pressure and superficial nephron glomerular filtration rate in response to a saturating increase of tubular perfusion flow. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mice for one allele are viable and fertile with increased circulating alkaline phosphatase and impaired tubuloglomerular feedback regulation. Homozygous null mice for a second allele display increased vascular permeability especially under hypoxic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acr T C 15: 89,569,751 V97A probably benign Het
Agrn C T 4: 156,173,662 G1081D probably benign Het
Ang2 A G 14: 51,195,503 S141P probably damaging Het
Apba2 A T 7: 64,695,982 T307S probably benign Het
AU019823 T C 9: 50,610,308 I104M probably benign Het
Cadm2 T A 16: 66,815,450 N84Y possibly damaging Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Ccdc62 T C 5: 123,954,385 C478R probably benign Het
Cep290 A C 10: 100,517,808 H801P probably benign Het
Chfr T A 5: 110,162,763 Y555* probably null Het
Cmas T C 6: 142,771,339 probably null Het
Cmtm7 T C 9: 114,763,347 I61V probably benign Het
Cyb5d2 A G 11: 72,778,825 S236P possibly damaging Het
Dcp1b C T 6: 119,215,436 Q438* probably null Het
Dgcr8 T C 16: 18,258,285 Q678R probably damaging Het
Emc1 T A 4: 139,365,210 M487K possibly damaging Het
Gm7361 T C 5: 26,262,156 S258P probably damaging Het
Hbs1l A G 10: 21,307,649 I96M probably benign Het
Ifi27l2a G A 12: 103,442,885 A49V unknown Het
Igkv10-96 T C 6: 68,632,104 Y69C possibly damaging Het
Igsf10 A T 3: 59,318,533 V2573D probably damaging Het
Kif20a A G 18: 34,626,922 T94A possibly damaging Het
Lcp2 T A 11: 34,082,394 V324E probably benign Het
Lmod3 T C 6: 97,247,418 K481E probably benign Het
Met A G 6: 17,571,672 E1330G probably damaging Het
Mroh1 GCCCAGGCCCC GCC 15: 76,432,215 probably null Het
Mss51 T C 14: 20,484,703 D333G possibly damaging Het
Nav3 A G 10: 109,705,603 V1933A probably benign Het
Nbas A G 12: 13,288,795 Y212C probably damaging Het
Npsr1 C T 9: 24,286,822 probably benign Het
Olfr1160 A T 2: 88,006,193 L186Q probably damaging Het
Olfr449 T C 6: 42,838,190 F103S probably damaging Het
Papss1 A G 3: 131,582,611 T136A probably benign Het
Pcdha1 A T 18: 36,930,814 D177V possibly damaging Het
Pcolce2 A T 9: 95,692,920 S308C probably damaging Het
Pdhx G T 2: 103,042,252 P162T probably benign Het
Plin3 C T 17: 56,286,268 R98Q probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rnf213 A G 11: 119,430,445 N1243S Het
Serpinb1b A T 13: 33,093,601 K272N probably benign Het
Syne1 A T 10: 5,146,257 M739K probably benign Het
Tbc1d9 G A 8: 83,240,038 probably null Het
Trp53inp1 A G 4: 11,164,561 D35G probably damaging Het
Trpc7 A G 13: 56,804,711 V549A probably damaging Het
Usp18 T C 6: 121,253,810 L66S probably damaging Het
Vmn1r238 C T 18: 3,122,529 S295N probably benign Het
Vmn2r29 T C 7: 7,241,942 D311G probably damaging Het
Vmn2r91 C A 17: 18,136,363 A764D probably damaging Het
Wdfy4 T A 14: 32,967,487 I3031F Het
Other mutations in Nt5e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01794:Nt5e APN 9 88367298 missense probably damaging 0.97
IGL02015:Nt5e APN 9 88367237 missense probably damaging 1.00
IGL02351:Nt5e APN 9 88327893 missense probably damaging 1.00
IGL02358:Nt5e APN 9 88327893 missense probably damaging 1.00
IGL02826:Nt5e APN 9 88355705 missense probably damaging 0.97
IGL03237:Nt5e APN 9 88355734 missense probably damaging 1.00
R0092:Nt5e UTSW 9 88370285 missense probably benign 0.00
R0238:Nt5e UTSW 9 88367332 missense possibly damaging 0.81
R0238:Nt5e UTSW 9 88367332 missense possibly damaging 0.81
R0557:Nt5e UTSW 9 88366466 missense probably damaging 1.00
R1727:Nt5e UTSW 9 88328029 missense possibly damaging 0.87
R1834:Nt5e UTSW 9 88370187 missense probably damaging 1.00
R2361:Nt5e UTSW 9 88370237 missense possibly damaging 0.67
R3871:Nt5e UTSW 9 88364693 missense probably benign 0.04
R4990:Nt5e UTSW 9 88355593 missense probably benign 0.03
R5039:Nt5e UTSW 9 88363581 missense probably benign 0.00
R5642:Nt5e UTSW 9 88327687 start codon destroyed probably null 0.02
R5812:Nt5e UTSW 9 88369055 missense probably damaging 1.00
R6389:Nt5e UTSW 9 88363471 missense probably damaging 1.00
R7003:Nt5e UTSW 9 88364752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATGTACAGCAGCAGATG -3'
(R):5'- GGGAGGCTAAATTCTTCACAAG -3'

Sequencing Primer
(F):5'- CAGCAGATGGTGAATCTCCAAGTC -3'
(R):5'- GAGGCTAAATTCTTCACAAGTGTCAC -3'
Posted On2020-09-02