Incidental Mutation 'R0068:Ccdc148'
ID 64406
Institutional Source Beutler Lab
Gene Symbol Ccdc148
Ensembl Gene ENSMUSG00000036641
Gene Name coiled-coil domain containing 148
Synonyms
MMRRC Submission 038359-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R0068 (G1)
Quality Score 130
Status Validated
Chromosome 2
Chromosomal Location 58711082-58991027 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58717629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 530 (E530G)
Ref Sequence ENSEMBL: ENSMUSP00000153944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077687] [ENSMUST00000226455]
AlphaFold Q6P5U8
Predicted Effect probably benign
Transcript: ENSMUST00000077687
AA Change: E458G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076871
Gene: ENSMUSG00000036641
AA Change: E458G

DomainStartEndE-ValueType
coiled coil region 173 195 N/A INTRINSIC
coiled coil region 289 353 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
coiled coil region 401 438 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134708
Predicted Effect probably benign
Transcript: ENSMUST00000226455
AA Change: E530G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0727 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.6%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,073,708 (GRCm39) T1448A probably damaging Het
Aldoart2 G T 12: 55,612,233 (GRCm39) E53* probably null Het
Ankra2 C T 13: 98,409,891 (GRCm39) Q137* probably null Het
Arpc1a C T 5: 145,028,054 (GRCm39) T21I possibly damaging Het
Arvcf T C 16: 18,214,819 (GRCm39) probably benign Het
Ash1l C A 3: 88,914,624 (GRCm39) S1751R probably benign Het
Bltp1 A G 3: 37,006,370 (GRCm39) T1675A probably benign Het
Bsn C A 9: 107,989,336 (GRCm39) G2139C probably damaging Het
Cct3 A G 3: 88,225,772 (GRCm39) D365G probably benign Het
Chd2 A T 7: 73,134,282 (GRCm39) S688R probably damaging Het
Crispld1 A G 1: 17,823,212 (GRCm39) T398A possibly damaging Het
Ctbp2 A C 7: 132,591,788 (GRCm39) V906G possibly damaging Het
Cwf19l1 A T 19: 44,119,938 (GRCm39) Y68N probably damaging Het
Dlc1 T A 8: 37,404,875 (GRCm39) M305L probably benign Het
Dnm1l C A 16: 16,141,883 (GRCm39) G288C probably damaging Het
Efcab3 T C 11: 104,611,648 (GRCm39) S497P probably benign Het
Fignl2 A T 15: 100,952,129 (GRCm39) I51N probably damaging Het
Flnb A G 14: 7,915,290 (GRCm38) N1474D possibly damaging Het
Ghrhr C T 6: 55,357,849 (GRCm39) probably benign Het
Hltf G A 3: 20,113,254 (GRCm39) R9H probably damaging Het
Hps5 A G 7: 46,426,466 (GRCm39) probably benign Het
Itpr3 T C 17: 27,323,034 (GRCm39) probably benign Het
Kansl1l A G 1: 66,760,047 (GRCm39) V911A probably benign Het
Kdm3b C T 18: 34,957,827 (GRCm39) T1064I probably benign Het
Lrriq1 T A 10: 102,899,279 (GRCm39) Q1654L probably benign Het
Ltbp1 A G 17: 75,666,404 (GRCm39) T1366A probably damaging Het
Mroh1 A G 15: 76,330,892 (GRCm39) probably benign Het
Mroh2a GT GTT 1: 88,183,888 (GRCm39) probably null Het
Napb G A 2: 148,540,843 (GRCm39) probably benign Het
Npc1 G C 18: 12,341,424 (GRCm39) P532A probably benign Het
Nrp2 G T 1: 62,784,536 (GRCm39) K228N possibly damaging Het
Or13f5 T A 4: 52,825,503 (GRCm39) Y35* probably null Het
Plekhg1 A T 10: 3,890,504 (GRCm39) K241* probably null Het
Poln T C 5: 34,234,432 (GRCm39) probably benign Het
Ppil1 A T 17: 29,471,230 (GRCm39) F92I probably damaging Het
Ppp1r9b T G 11: 94,892,046 (GRCm39) F154V probably damaging Het
Ptchd3 T G 11: 121,733,798 (GRCm39) L896R probably damaging Het
Rev3l A G 10: 39,700,827 (GRCm39) N1775D possibly damaging Het
Rusc2 T C 4: 43,424,100 (GRCm39) probably benign Het
Selenbp2 T C 3: 94,610,816 (GRCm39) V294A probably benign Het
Slc25a48 T C 13: 56,599,024 (GRCm39) V118A probably damaging Het
Slc38a10 T C 11: 120,025,679 (GRCm39) D219G probably damaging Het
Slc38a2 C T 15: 96,589,173 (GRCm39) probably null Het
Slc39a12 A G 2: 14,440,489 (GRCm39) E480G probably benign Het
Tab2 C A 10: 7,795,441 (GRCm39) R347L probably damaging Het
Tas2r123 T C 6: 132,824,955 (GRCm39) I284T possibly damaging Het
Tnks1bp1 T A 2: 84,892,696 (GRCm39) D212E probably benign Het
Trim67 T C 8: 125,521,307 (GRCm39) V223A probably damaging Het
Ugcg A G 4: 59,217,130 (GRCm39) D218G probably benign Het
Vmn2r59 A G 7: 41,695,725 (GRCm39) L229S probably damaging Het
Zfp451 A T 1: 33,816,706 (GRCm39) L198I probably damaging Het
Other mutations in Ccdc148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Ccdc148 APN 2 58,719,811 (GRCm39) missense probably benign 0.00
IGL02056:Ccdc148 APN 2 58,894,081 (GRCm39) splice site probably benign
IGL02470:Ccdc148 APN 2 58,891,911 (GRCm39) missense probably damaging 0.96
PIT4585001:Ccdc148 UTSW 2 58,872,988 (GRCm39) missense probably benign 0.01
R0068:Ccdc148 UTSW 2 58,717,629 (GRCm39) missense probably benign
R0348:Ccdc148 UTSW 2 58,894,084 (GRCm39) splice site probably null
R1464:Ccdc148 UTSW 2 58,824,455 (GRCm39) missense probably damaging 1.00
R1464:Ccdc148 UTSW 2 58,824,455 (GRCm39) missense probably damaging 1.00
R1464:Ccdc148 UTSW 2 58,796,374 (GRCm39) nonsense probably null
R1464:Ccdc148 UTSW 2 58,796,374 (GRCm39) nonsense probably null
R1675:Ccdc148 UTSW 2 58,870,566 (GRCm39) missense probably damaging 0.96
R1677:Ccdc148 UTSW 2 58,892,176 (GRCm39) missense probably damaging 1.00
R1832:Ccdc148 UTSW 2 58,891,911 (GRCm39) missense probably damaging 0.96
R1918:Ccdc148 UTSW 2 58,872,911 (GRCm39) missense probably damaging 1.00
R2114:Ccdc148 UTSW 2 58,892,128 (GRCm39) missense probably damaging 1.00
R2115:Ccdc148 UTSW 2 58,892,128 (GRCm39) missense probably damaging 1.00
R4657:Ccdc148 UTSW 2 58,891,900 (GRCm39) missense probably benign 0.04
R4921:Ccdc148 UTSW 2 58,719,814 (GRCm39) missense probably damaging 1.00
R5022:Ccdc148 UTSW 2 58,717,644 (GRCm39) missense probably damaging 1.00
R5809:Ccdc148 UTSW 2 58,713,657 (GRCm39) missense probably damaging 1.00
R6164:Ccdc148 UTSW 2 58,713,645 (GRCm39) missense probably damaging 1.00
R6952:Ccdc148 UTSW 2 58,713,657 (GRCm39) missense probably damaging 1.00
R6987:Ccdc148 UTSW 2 58,872,926 (GRCm39) missense probably damaging 1.00
R7121:Ccdc148 UTSW 2 58,717,579 (GRCm39) missense probably damaging 1.00
R7452:Ccdc148 UTSW 2 58,717,596 (GRCm39) missense probably damaging 1.00
R7493:Ccdc148 UTSW 2 58,899,160 (GRCm39) missense probably damaging 1.00
R7574:Ccdc148 UTSW 2 58,713,645 (GRCm39) missense probably damaging 1.00
R7666:Ccdc148 UTSW 2 58,824,512 (GRCm39) missense probably damaging 0.99
R7763:Ccdc148 UTSW 2 58,713,648 (GRCm39) missense probably benign
R8045:Ccdc148 UTSW 2 58,892,083 (GRCm39) critical splice donor site probably null
R8865:Ccdc148 UTSW 2 58,719,832 (GRCm39) missense possibly damaging 0.86
R8932:Ccdc148 UTSW 2 58,894,054 (GRCm39) missense probably benign 0.40
R9597:Ccdc148 UTSW 2 58,893,397 (GRCm39) missense probably benign 0.08
X0062:Ccdc148 UTSW 2 58,893,460 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCTGCAAATAGCTCCACGATCCC -3'
(R):5'- TTGTAAGTAACTGGCACTGGCCTG -3'

Sequencing Primer
(F):5'- CCTTAGCTCTGAGAACAAAACTTGTG -3'
(R):5'- CCTCTACAGCTTTAGACTTAATACG -3'
Posted On 2013-08-06