Incidental Mutation 'R8325:Lcp2'
ID644065
Institutional Source Beutler Lab
Gene Symbol Lcp2
Ensembl Gene ENSMUSG00000002699
Gene Namelymphocyte cytosolic protein 2
Synonymstwm, SLP76, SLP-76
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8325 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location34046920-34092295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34082394 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 324 (V324E)
Ref Sequence ENSEMBL: ENSMUSP00000056621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052413] [ENSMUST00000109329]
Predicted Effect probably benign
Transcript: ENSMUST00000052413
AA Change: V324E

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056621
Gene: ENSMUSG00000002699
AA Change: V324E

DomainStartEndE-ValueType
SAM 12 78 9.3e-4 SMART
low complexity region 109 127 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
internal_repeat_1 274 321 1.93e-5 PROSPERO
low complexity region 328 339 N/A INTRINSIC
low complexity region 400 412 N/A INTRINSIC
SH2 421 512 4.44e-25 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000104952
Gene: ENSMUSG00000002699
AA Change: V324E

DomainStartEndE-ValueType
SAM 12 78 9.3e-4 SMART
low complexity region 109 127 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
internal_repeat_1 274 321 1.86e-5 PROSPERO
low complexity region 328 339 N/A INTRINSIC
low complexity region 400 412 N/A INTRINSIC
SH2 421 508 8.9e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that acts as a substrate of the T cell antigen receptor (TCR)-activated protein tyrosine kinase pathway. The encoded protein associates with growth factor receptor bound protein 2, and is thought to play a role TCR-mediated intracellular signal transduction. A similar protein in mouse plays a role in normal T-cell development and activation. Mice lacking this gene show subcutaneous and intraperitoneal fetal hemorrhaging, dysfunctional platelets and impaired viability. [provided by RefSeq, Nov 2016]
PHENOTYPE: T cell development is blocked and T cell receptor signaling impaired in homozygous point mutants. Double positive thymocyte and single positive T cell numbers are much reduced. Both positive and negative thymocyte selection is abnormal. Mice have high IgG and IgE levels and exhibit autoimmunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acr T C 15: 89,569,751 V97A probably benign Het
Agrn C T 4: 156,173,662 G1081D probably benign Het
Ang2 A G 14: 51,195,503 S141P probably damaging Het
Ap3b2 T C 7: 81,484,489 probably null Het
Apba2 A T 7: 64,695,982 T307S probably benign Het
AU019823 T C 9: 50,610,308 I104M probably benign Het
Cadm2 T A 16: 66,815,450 N84Y possibly damaging Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Ccdc62 T C 5: 123,954,385 C478R probably benign Het
Cep290 A C 10: 100,517,808 H801P probably benign Het
Chfr T A 5: 110,162,763 Y555* probably null Het
Cmas T C 6: 142,771,339 probably null Het
Cmtm7 T C 9: 114,763,347 I61V probably benign Het
Cyb5d2 A G 11: 72,778,825 S236P possibly damaging Het
Dcp1b C T 6: 119,215,436 Q438* probably null Het
Dgcr8 T C 16: 18,258,285 Q678R probably damaging Het
Emc1 T A 4: 139,365,210 M487K possibly damaging Het
Gm7361 T C 5: 26,262,156 S258P probably damaging Het
Hbs1l A G 10: 21,307,649 I96M probably benign Het
Ifi27l2a G A 12: 103,442,885 A49V unknown Het
Igkv10-96 T C 6: 68,632,104 Y69C possibly damaging Het
Igsf10 A T 3: 59,318,533 V2573D probably damaging Het
Kcng3 T C 17: 83,631,578 N14S possibly damaging Het
Kif20a A G 18: 34,626,922 T94A possibly damaging Het
Lmod3 T C 6: 97,247,418 K481E probably benign Het
Met A G 6: 17,571,672 E1330G probably damaging Het
Mroh1 GCCCAGGCCCC GCC 15: 76,432,215 probably null Het
Mss51 T C 14: 20,484,703 D333G possibly damaging Het
Nav3 A G 10: 109,705,603 V1933A probably benign Het
Nbas A G 12: 13,288,795 Y212C probably damaging Het
Npsr1 C T 9: 24,286,822 probably benign Het
Nt5e A G 9: 88,363,562 E295G probably benign Het
Olfr1160 A T 2: 88,006,193 L186Q probably damaging Het
Olfr449 T C 6: 42,838,190 F103S probably damaging Het
Papss1 A G 3: 131,582,611 T136A probably benign Het
Pcdha1 A T 18: 36,930,814 D177V possibly damaging Het
Pcolce2 A T 9: 95,692,920 S308C probably damaging Het
Pdhx G T 2: 103,042,252 P162T probably benign Het
Plin3 C T 17: 56,286,268 R98Q probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rnf213 A G 11: 119,430,445 N1243S Het
Serpinb1b A T 13: 33,093,601 K272N probably benign Het
Sez6l A T 5: 112,428,116 probably null Het
Syne1 A T 10: 5,146,257 M739K probably benign Het
Tbc1d9 G A 8: 83,240,038 probably null Het
Trp53inp1 A G 4: 11,164,561 D35G probably damaging Het
Trpc7 A G 13: 56,804,711 V549A probably damaging Het
Usp18 T C 6: 121,253,810 L66S probably damaging Het
Vmn1r238 C T 18: 3,122,529 S295N probably benign Het
Vmn2r29 T C 7: 7,241,942 D311G probably damaging Het
Vmn2r91 C A 17: 18,136,363 A764D probably damaging Het
Wdfy4 T A 14: 32,967,487 I3031F Het
Wdr7 A G 18: 63,778,464 probably null Het
Other mutations in Lcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Lcp2 APN 11 34047345 start gained probably benign
IGL01730:Lcp2 APN 11 34050943 missense possibly damaging 0.91
IGL02174:Lcp2 APN 11 34050966 splice site probably benign
IGL02228:Lcp2 APN 11 34047424 missense probably damaging 1.00
IGL02814:Lcp2 APN 11 34071033 missense probably damaging 1.00
R0142:Lcp2 UTSW 11 34082418 missense probably damaging 0.97
R0277:Lcp2 UTSW 11 34054322 missense probably damaging 1.00
R0281:Lcp2 UTSW 11 34069854 splice site probably benign
R0323:Lcp2 UTSW 11 34054322 missense probably damaging 1.00
R0437:Lcp2 UTSW 11 34087229 missense probably benign 0.00
R0632:Lcp2 UTSW 11 34082426 missense possibly damaging 0.87
R1479:Lcp2 UTSW 11 34075068 missense probably benign 0.01
R1570:Lcp2 UTSW 11 34089601 missense probably benign 0.07
R1744:Lcp2 UTSW 11 34069911 splice site probably null
R2212:Lcp2 UTSW 11 34070995 missense probably benign 0.14
R2910:Lcp2 UTSW 11 34068970 splice site probably null
R2911:Lcp2 UTSW 11 34068970 splice site probably null
R3196:Lcp2 UTSW 11 34090670 missense probably benign 0.05
R4012:Lcp2 UTSW 11 34068439 missense probably damaging 1.00
R4411:Lcp2 UTSW 11 34087173 unclassified probably benign
R4417:Lcp2 UTSW 11 34050917 missense probably benign 0.27
R4423:Lcp2 UTSW 11 34078226 intron probably benign
R4718:Lcp2 UTSW 11 34070992 missense probably benign 0.09
R5090:Lcp2 UTSW 11 34089725 nonsense probably null
R6347:Lcp2 UTSW 11 34082501 missense probably benign 0.10
R7315:Lcp2 UTSW 11 34069906 critical splice donor site probably null
R7694:Lcp2 UTSW 11 34050924 missense probably benign 0.16
R7910:Lcp2 UTSW 11 34088061 missense probably damaging 1.00
R8435:Lcp2 UTSW 11 34054316 missense probably damaging 1.00
R8709:Lcp2 UTSW 11 34054354 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TACAGAACAATAGCGATGTCAAGTG -3'
(R):5'- CCACCAGGCGCTATGCTTAG -3'

Sequencing Primer
(F):5'- TAGCGATGTCAAGTGACTCC -3'
(R):5'- GCTAGAGCTGAGGGGCAC -3'
Posted On2020-09-02