Mutagenetix > Incidental Mutation

Incidental Mutation 'R8325:Lcp2'

644065

Institutional Source

Beutler Lab

Gene Symbol

Lcp2

Ensembl Gene

ENSMUSG00000002699

Gene Name

lymphocyte cytosolic protein 2

Synonyms

twm, SLP76, SLP-76

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8325 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34046920-34092295 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34082394 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 324 (V324E)

Ref Sequence

ENSEMBL: ENSMUSP00000056621 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052413] [ENSMUST00000109329]

AlphaFold

Q60787

Predicted Effect

probably benign
Transcript: ENSMUST00000052413
AA Change: V324E

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000056621
Gene: ENSMUSG00000002699
AA Change: V324E

Domain	Start	End	E-Value	Type
SAM	12	78	9.3e-4	SMART
low complexity region	109	127	N/A	INTRINSIC
low complexity region	186	201	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
internal_repeat_1	274	321	1.93e-5	PROSPERO
low complexity region	328	339	N/A	INTRINSIC
low complexity region	400	412	N/A	INTRINSIC
SH2	421	512	4.44e-25	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000104952
Gene: ENSMUSG00000002699
AA Change: V324E

Domain	Start	End	E-Value	Type
SAM	12	78	9.3e-4	SMART
low complexity region	109	127	N/A	INTRINSIC
low complexity region	186	201	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
internal_repeat_1	274	321	1.86e-5	PROSPERO
low complexity region	328	339	N/A	INTRINSIC
low complexity region	400	412	N/A	INTRINSIC
SH2	421	508	8.9e-16	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that acts as a substrate of the T cell antigen receptor (TCR)-activated protein tyrosine kinase pathway. The encoded protein associates with growth factor receptor bound protein 2, and is thought to play a role TCR-mediated intracellular signal transduction. A similar protein in mouse plays a role in normal T-cell development and activation. Mice lacking this gene show subcutaneous and intraperitoneal fetal hemorrhaging, dysfunctional platelets and impaired viability. [provided by RefSeq, Nov 2016]
PHENOTYPE: T cell development is blocked and T cell receptor signaling impaired in homozygous point mutants. Double positive thymocyte and single positive T cell numbers are much reduced. Both positive and negative thymocyte selection is abnormal. Mice have high IgG and IgE levels and exhibit autoimmunity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acr	T	C	15: 89,569,751	V97A	probably benign	Het
Agrn	C	T	4: 156,173,662	G1081D	probably benign	Het
Ang2	A	G	14: 51,195,503	S141P	probably damaging	Het
Ap3b2	T	C	7: 81,484,489		probably null	Het
Apba2	A	T	7: 64,695,982	T307S	probably benign	Het
AU019823	T	C	9: 50,610,308	I104M	probably benign	Het
Cadm2	T	A	16: 66,815,450	N84Y	possibly damaging	Het
Camsap1	T	C	2: 25,939,363	D783G	probably benign	Het
Ccdc62	T	C	5: 123,954,385	C478R	probably benign	Het
Cep290	A	C	10: 100,517,808	H801P	probably benign	Het
Chfr	T	A	5: 110,162,763	Y555*	probably null	Het
Cmas	T	C	6: 142,771,339		probably null	Het
Cmtm7	T	C	9: 114,763,347	I61V	probably benign	Het
Cyb5d2	A	G	11: 72,778,825	S236P	possibly damaging	Het
Dcp1b	C	T	6: 119,215,436	Q438*	probably null	Het
Dgcr8	T	C	16: 18,258,285	Q678R	probably damaging	Het
Emc1	T	A	4: 139,365,210	M487K	possibly damaging	Het
Gm7361	T	C	5: 26,262,156	S258P	probably damaging	Het
Hbs1l	A	G	10: 21,307,649	I96M	probably benign	Het
Ifi27l2a	G	A	12: 103,442,885	A49V	unknown	Het
Igkv10-96	T	C	6: 68,632,104	Y69C	possibly damaging	Het
Igsf10	A	T	3: 59,318,533	V2573D	probably damaging	Het
Kcng3	T	C	17: 83,631,578	N14S	possibly damaging	Het
Kif20a	A	G	18: 34,626,922	T94A	possibly damaging	Het
Lmod3	T	C	6: 97,247,418	K481E	probably benign	Het
Met	A	G	6: 17,571,672	E1330G	probably damaging	Het
Mroh1	GCCCAGGCCCC	GCC	15: 76,432,215		probably null	Het
Mss51	T	C	14: 20,484,703	D333G	possibly damaging	Het
Nav3	A	G	10: 109,705,603	V1933A	probably benign	Het
Nbas	A	G	12: 13,288,795	Y212C	probably damaging	Het
Npsr1	C	T	9: 24,286,822		probably benign	Het
Nt5e	A	G	9: 88,363,562	E295G	probably benign	Het
Olfr1160	A	T	2: 88,006,193	L186Q	probably damaging	Het
Olfr449	T	C	6: 42,838,190	F103S	probably damaging	Het
Papss1	A	G	3: 131,582,611	T136A	probably benign	Het
Pcdha1	A	T	18: 36,930,814	D177V	possibly damaging	Het
Pcolce2	A	T	9: 95,692,920	S308C	probably damaging	Het
Pdhx	G	T	2: 103,042,252	P162T	probably benign	Het
Plin3	C	T	17: 56,286,268	R98Q	probably benign	Het
Prr36	T	C	8: 4,212,982	T895A	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rnf213	A	G	11: 119,430,445	N1243S		Het
Serpinb1b	A	T	13: 33,093,601	K272N	probably benign	Het
Sez6l	A	T	5: 112,428,116		probably null	Het
Syne1	A	T	10: 5,146,257	M739K	probably benign	Het
Tbc1d9	G	A	8: 83,240,038		probably null	Het
Trp53inp1	A	G	4: 11,164,561	D35G	probably damaging	Het
Trpc7	A	G	13: 56,804,711	V549A	probably damaging	Het
Usp18	T	C	6: 121,253,810	L66S	probably damaging	Het
Vmn1r238	C	T	18: 3,122,529	S295N	probably benign	Het
Vmn2r29	T	C	7: 7,241,942	D311G	probably damaging	Het
Vmn2r91	C	A	17: 18,136,363	A764D	probably damaging	Het
Wdfy4	T	A	14: 32,967,487	I3031F		Het
Wdr7	A	G	18: 63,778,464		probably null	Het

Other mutations in Lcp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01451:Lcp2	APN	11	34047345	start gained	probably benign
IGL01730:Lcp2	APN	11	34050943	missense	possibly damaging	0.91
IGL02174:Lcp2	APN	11	34050966	splice site	probably benign
IGL02228:Lcp2	APN	11	34047424	missense	probably damaging	1.00
IGL02814:Lcp2	APN	11	34071033	missense	probably damaging	1.00
R0142:Lcp2	UTSW	11	34082418	missense	probably damaging	0.97
R0277:Lcp2	UTSW	11	34054322	missense	probably damaging	1.00
R0281:Lcp2	UTSW	11	34069854	splice site	probably benign
R0323:Lcp2	UTSW	11	34054322	missense	probably damaging	1.00
R0437:Lcp2	UTSW	11	34087229	missense	probably benign	0.00
R0632:Lcp2	UTSW	11	34082426	missense	possibly damaging	0.87
R1479:Lcp2	UTSW	11	34075068	missense	probably benign	0.01
R1570:Lcp2	UTSW	11	34089601	missense	probably benign	0.07
R1744:Lcp2	UTSW	11	34069911	splice site	probably null
R2212:Lcp2	UTSW	11	34070995	missense	probably benign	0.14
R2910:Lcp2	UTSW	11	34068970	splice site	probably null
R2911:Lcp2	UTSW	11	34068970	splice site	probably null
R3196:Lcp2	UTSW	11	34090670	missense	probably benign	0.05
R4012:Lcp2	UTSW	11	34068439	missense	probably damaging	1.00
R4411:Lcp2	UTSW	11	34087173	unclassified	probably benign
R4417:Lcp2	UTSW	11	34050917	missense	probably benign	0.27
R4423:Lcp2	UTSW	11	34078226	intron	probably benign
R4718:Lcp2	UTSW	11	34070992	missense	probably benign	0.09
R5090:Lcp2	UTSW	11	34089725	nonsense	probably null
R6347:Lcp2	UTSW	11	34082501	missense	probably benign	0.10
R7315:Lcp2	UTSW	11	34069906	critical splice donor site	probably null
R7694:Lcp2	UTSW	11	34050924	missense	probably benign	0.16
R7910:Lcp2	UTSW	11	34088061	missense	probably damaging	1.00
R8435:Lcp2	UTSW	11	34054316	missense	probably damaging	1.00
R8709:Lcp2	UTSW	11	34054354	critical splice donor site	probably benign
R9091:Lcp2	UTSW	11	34089688	missense
R9270:Lcp2	UTSW	11	34089688	missense
R9566:Lcp2	UTSW	11	34050944	missense

Predicted Primers

PCR Primer
(F):5'- TACAGAACAATAGCGATGTCAAGTG -3'
(R):5'- CCACCAGGCGCTATGCTTAG -3'

Sequencing Primer
(F):5'- TAGCGATGTCAAGTGACTCC -3'
(R):5'- GCTAGAGCTGAGGGGCAC -3'

Posted On

2020-09-02