Incidental Mutation 'R0068:Tnks1bp1'
ID64407
Institutional Source Beutler Lab
Gene Symbol Tnks1bp1
Ensembl Gene ENSMUSG00000033955
Gene Nametankyrase 1 binding protein 1
SynonymsTAB182
MMRRC Submission 038359-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0068 (G1)
Quality Score121
Status Validated
Chromosome2
Chromosomal Location85048022-85073048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85062352 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 212 (D212E)
Ref Sequence ENSEMBL: ENSMUSP00000045767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048400] [ENSMUST00000111605]
Predicted Effect probably benign
Transcript: ENSMUST00000048400
AA Change: D212E

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045767
Gene: ENSMUSG00000033955
AA Change: D212E

DomainStartEndE-ValueType
low complexity region 77 96 N/A INTRINSIC
low complexity region 292 298 N/A INTRINSIC
low complexity region 809 827 N/A INTRINSIC
low complexity region 868 875 N/A INTRINSIC
Tankyrase_bdg_C 883 1055 1.98e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111605
AA Change: D874E

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107232
Gene: ENSMUSG00000033955
AA Change: D874E

DomainStartEndE-ValueType
low complexity region 37 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 739 758 N/A INTRINSIC
low complexity region 954 960 N/A INTRINSIC
low complexity region 1471 1489 N/A INTRINSIC
low complexity region 1530 1537 N/A INTRINSIC
Tankyrase_bdg_C 1545 1717 1.98e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151092
Meta Mutation Damage Score 0.1727 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.6%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,952,221 T1675A probably benign Het
Abca6 T C 11: 110,182,882 T1448A probably damaging Het
Aldoart2 G T 12: 55,565,448 E53* probably null Het
Ankra2 C T 13: 98,273,383 Q137* probably null Het
Arpc1a C T 5: 145,091,244 T21I possibly damaging Het
Arvcf T C 16: 18,396,954 probably benign Het
Ash1l C A 3: 89,007,317 S1751R probably benign Het
Bsn C A 9: 108,112,137 G2139C probably damaging Het
Ccdc148 T C 2: 58,827,617 E530G probably benign Het
Cct3 A G 3: 88,318,465 D365G probably benign Het
Chd2 A T 7: 73,484,534 S688R probably damaging Het
Crispld1 A G 1: 17,752,988 T398A possibly damaging Het
Ctbp2 A C 7: 132,990,059 V906G possibly damaging Het
Cwf19l1 A T 19: 44,131,499 Y68N probably damaging Het
Dlc1 T A 8: 36,937,721 M305L probably benign Het
Dnm1l C A 16: 16,324,019 G288C probably damaging Het
Fignl2 A T 15: 101,054,248 I51N probably damaging Het
Flnb A G 14: 7,915,290 N1474D possibly damaging Het
Ghrhr C T 6: 55,380,864 probably benign Het
Gm11639 T C 11: 104,720,822 S497P probably benign Het
Hltf G A 3: 20,059,090 R9H probably damaging Het
Hps5 A G 7: 46,777,042 probably benign Het
Itpr3 T C 17: 27,104,060 probably benign Het
Kansl1l A G 1: 66,720,888 V911A probably benign Het
Kdm3b C T 18: 34,824,774 T1064I probably benign Het
Lrriq1 T A 10: 103,063,418 Q1654L probably benign Het
Ltbp1 A G 17: 75,359,409 T1366A probably damaging Het
Mroh1 A G 15: 76,446,692 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Napb G A 2: 148,698,923 probably benign Het
Npc1 G C 18: 12,208,367 P532A probably benign Het
Nrp2 G T 1: 62,745,377 K228N possibly damaging Het
Olfr275 T A 4: 52,825,503 Y35* probably null Het
Plekhg1 A T 10: 3,940,504 K241* probably null Het
Poln T C 5: 34,077,088 probably benign Het
Ppil1 A T 17: 29,252,256 F92I probably damaging Het
Ppp1r9b T G 11: 95,001,220 F154V probably damaging Het
Ptchd3 T G 11: 121,842,972 L896R probably damaging Het
Rev3l A G 10: 39,824,831 N1775D possibly damaging Het
Rusc2 T C 4: 43,424,100 probably benign Het
Selenbp2 T C 3: 94,703,509 V294A probably benign Het
Slc25a48 T C 13: 56,451,211 V118A probably damaging Het
Slc38a10 T C 11: 120,134,853 D219G probably damaging Het
Slc38a2 C T 15: 96,691,292 probably null Het
Slc39a12 A G 2: 14,435,678 E480G probably benign Het
Tab2 C A 10: 7,919,677 R347L probably damaging Het
Tas2r123 T C 6: 132,847,992 I284T possibly damaging Het
Trim67 T C 8: 124,794,568 V223A probably damaging Het
Ugcg A G 4: 59,217,130 D218G probably benign Het
Vmn2r59 A G 7: 42,046,301 L229S probably damaging Het
Zfp451 A T 1: 33,777,625 L198I probably damaging Het
Other mutations in Tnks1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Tnks1bp1 APN 2 85062236 nonsense probably null
IGL00974:Tnks1bp1 APN 2 85062882 missense possibly damaging 0.92
IGL01874:Tnks1bp1 APN 2 85058447 missense probably benign 0.01
IGL02419:Tnks1bp1 APN 2 85071781 missense possibly damaging 0.60
IGL02441:Tnks1bp1 APN 2 85071799 missense probably damaging 1.00
IGL02475:Tnks1bp1 APN 2 85059377 missense probably damaging 1.00
IGL03181:Tnks1bp1 APN 2 85062714 missense probably benign 0.00
K3955:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
P0038:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
PIT4791001:Tnks1bp1 UTSW 2 85062558 missense probably benign 0.03
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0189:Tnks1bp1 UTSW 2 85070929 missense possibly damaging 0.77
R0454:Tnks1bp1 UTSW 2 85072137 missense probably damaging 1.00
R0650:Tnks1bp1 UTSW 2 85062630 missense possibly damaging 0.68
R0737:Tnks1bp1 UTSW 2 85052536 missense possibly damaging 0.93
R1718:Tnks1bp1 UTSW 2 85071738 missense probably benign 0.44
R1749:Tnks1bp1 UTSW 2 85063067 missense probably benign
R2194:Tnks1bp1 UTSW 2 85063065 missense probably benign 0.06
R2314:Tnks1bp1 UTSW 2 85058915 missense probably benign 0.01
R2379:Tnks1bp1 UTSW 2 85063838 missense probably benign 0.16
R3056:Tnks1bp1 UTSW 2 85070000 nonsense probably null
R3433:Tnks1bp1 UTSW 2 85071016 splice site probably benign
R3751:Tnks1bp1 UTSW 2 85058722 start gained probably benign
R4502:Tnks1bp1 UTSW 2 85062647 nonsense probably null
R4694:Tnks1bp1 UTSW 2 85071722 missense probably damaging 1.00
R4785:Tnks1bp1 UTSW 2 85063034 missense probably damaging 1.00
R5079:Tnks1bp1 UTSW 2 85062626 missense probably damaging 1.00
R5208:Tnks1bp1 UTSW 2 85070632 missense probably damaging 0.96
R5265:Tnks1bp1 UTSW 2 85062754 missense probably benign 0.01
R5512:Tnks1bp1 UTSW 2 85062834 missense probably benign 0.00
R5557:Tnks1bp1 UTSW 2 85063800 missense probably damaging 0.97
R6016:Tnks1bp1 UTSW 2 85052390 missense probably damaging 1.00
R6177:Tnks1bp1 UTSW 2 85059280 start gained probably benign
R6516:Tnks1bp1 UTSW 2 85070727 missense probably damaging 0.97
R6517:Tnks1bp1 UTSW 2 85059345 missense probably benign 0.00
R7032:Tnks1bp1 UTSW 2 85061953 missense probably benign 0.00
R7120:Tnks1bp1 UTSW 2 85072097 missense probably damaging 1.00
R7302:Tnks1bp1 UTSW 2 85052354 missense probably benign 0.24
R7393:Tnks1bp1 UTSW 2 85062866 missense probably benign
R7535:Tnks1bp1 UTSW 2 85063280 nonsense probably null
R7596:Tnks1bp1 UTSW 2 85062713 missense probably benign 0.14
R7680:Tnks1bp1 UTSW 2 85059241 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CACACCACAGCAGTTTTGGTTCTTC -3'
(R):5'- CAGAATCTCGCTTCTCAAACTCCCG -3'

Sequencing Primer
(F):5'- AGCTGGTCTCAAGACACTTC -3'
(R):5'- CAAACTCCCGGTCCTGC -3'
Posted On2013-08-06