Incidental Mutation 'R8325:Vmn1r238'
ID644081
Institutional Source Beutler Lab
Gene Symbol Vmn1r238
Ensembl Gene ENSMUSG00000091539
Gene Namevomeronasal 1 receptor, 238
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8325 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location3122492-3123412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3122529 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 295 (S295N)
Ref Sequence ENSEMBL: ENSMUSP00000129804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165255]
Predicted Effect probably benign
Transcript: ENSMUST00000165255
AA Change: S295N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000129804
Gene: ENSMUSG00000091539
AA Change: S295N

DomainStartEndE-ValueType
Pfam:TAS2R 7 302 5.3e-8 PFAM
Pfam:7tm_1 27 292 8.8e-7 PFAM
Pfam:V1R 34 298 1.9e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acr T C 15: 89,569,751 V97A probably benign Het
Agrn C T 4: 156,173,662 G1081D probably benign Het
Ang2 A G 14: 51,195,503 S141P probably damaging Het
Apba2 A T 7: 64,695,982 T307S probably benign Het
AU019823 T C 9: 50,610,308 I104M probably benign Het
Cadm2 T A 16: 66,815,450 N84Y possibly damaging Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Ccdc62 T C 5: 123,954,385 C478R probably benign Het
Cep290 A C 10: 100,517,808 H801P probably benign Het
Chfr T A 5: 110,162,763 Y555* probably null Het
Cmas T C 6: 142,771,339 probably null Het
Cmtm7 T C 9: 114,763,347 I61V probably benign Het
Cyb5d2 A G 11: 72,778,825 S236P possibly damaging Het
Dcp1b C T 6: 119,215,436 Q438* probably null Het
Dgcr8 T C 16: 18,258,285 Q678R probably damaging Het
Emc1 T A 4: 139,365,210 M487K possibly damaging Het
Gm7361 T C 5: 26,262,156 S258P probably damaging Het
Hbs1l A G 10: 21,307,649 I96M probably benign Het
Ifi27l2a G A 12: 103,442,885 A49V unknown Het
Igkv10-96 T C 6: 68,632,104 Y69C possibly damaging Het
Igsf10 A T 3: 59,318,533 V2573D probably damaging Het
Kif20a A G 18: 34,626,922 T94A possibly damaging Het
Lcp2 T A 11: 34,082,394 V324E probably benign Het
Lmod3 T C 6: 97,247,418 K481E probably benign Het
Met A G 6: 17,571,672 E1330G probably damaging Het
Mroh1 GCCCAGGCCCC GCC 15: 76,432,215 probably null Het
Mss51 T C 14: 20,484,703 D333G possibly damaging Het
Nav3 A G 10: 109,705,603 V1933A probably benign Het
Nbas A G 12: 13,288,795 Y212C probably damaging Het
Npsr1 C T 9: 24,286,822 probably benign Het
Nt5e A G 9: 88,363,562 E295G probably benign Het
Olfr1160 A T 2: 88,006,193 L186Q probably damaging Het
Olfr449 T C 6: 42,838,190 F103S probably damaging Het
Papss1 A G 3: 131,582,611 T136A probably benign Het
Pcdha1 A T 18: 36,930,814 D177V possibly damaging Het
Pcolce2 A T 9: 95,692,920 S308C probably damaging Het
Pdhx G T 2: 103,042,252 P162T probably benign Het
Plin3 C T 17: 56,286,268 R98Q probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rnf213 A G 11: 119,430,445 N1243S Het
Serpinb1b A T 13: 33,093,601 K272N probably benign Het
Syne1 A T 10: 5,146,257 M739K probably benign Het
Tbc1d9 G A 8: 83,240,038 probably null Het
Trp53inp1 A G 4: 11,164,561 D35G probably damaging Het
Trpc7 A G 13: 56,804,711 V549A probably damaging Het
Usp18 T C 6: 121,253,810 L66S probably damaging Het
Vmn2r29 T C 7: 7,241,942 D311G probably damaging Het
Vmn2r91 C A 17: 18,136,363 A764D probably damaging Het
Wdfy4 T A 14: 32,967,487 I3031F Het
Other mutations in Vmn1r238
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn1r238 APN 18 3123243 missense probably benign 0.01
IGL01385:Vmn1r238 APN 18 3122770 missense possibly damaging 0.83
IGL02716:Vmn1r238 APN 18 3123124 missense probably damaging 1.00
R1219:Vmn1r238 UTSW 18 3123135 missense possibly damaging 0.81
R1568:Vmn1r238 UTSW 18 3123358 missense probably benign 0.00
R1864:Vmn1r238 UTSW 18 3123040 nonsense probably null
R3024:Vmn1r238 UTSW 18 3123305 missense probably benign 0.13
R4291:Vmn1r238 UTSW 18 3123214 nonsense probably null
R4304:Vmn1r238 UTSW 18 3123040 nonsense probably null
R4586:Vmn1r238 UTSW 18 3123294 missense probably damaging 1.00
R4664:Vmn1r238 UTSW 18 3123300 missense probably damaging 0.99
R5123:Vmn1r238 UTSW 18 3123243 missense probably benign
R5430:Vmn1r238 UTSW 18 3122521 missense possibly damaging 0.63
R5834:Vmn1r238 UTSW 18 3123168 missense probably benign
R7186:Vmn1r238 UTSW 18 3122661 missense probably damaging 0.99
R7206:Vmn1r238 UTSW 18 3122623 missense possibly damaging 0.94
R7308:Vmn1r238 UTSW 18 3122875 missense probably benign 0.09
R7346:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R7467:Vmn1r238 UTSW 18 3123393 missense probably benign 0.10
R7571:Vmn1r238 UTSW 18 3122721 missense probably damaging 1.00
R7808:Vmn1r238 UTSW 18 3123033 missense probably benign 0.03
R8085:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R8086:Vmn1r238 UTSW 18 3123250 missense probably damaging 1.00
R8423:Vmn1r238 UTSW 18 3123365 nonsense probably null
Z1177:Vmn1r238 UTSW 18 3122505 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCACAAAATTTTCTACTGATCATTCC -3'
(R):5'- CTTTCTGAAAGTCTCACCTGAAGAC -3'

Sequencing Primer
(F):5'- GTTTTAGCATTGTGTAACAGA -3'
(R):5'- GTCTCACCTGAAGACAGAGC -3'
Posted On2020-09-02