Incidental Mutation 'R8326:Slc16a14'
ID644088
Institutional Source Beutler Lab
Gene Symbol Slc16a14
Ensembl Gene ENSMUSG00000026220
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 14
Synonyms1110004H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R8326 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location84905898-84935134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84912345 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 413 (I413N)
Ref Sequence ENSEMBL: ENSMUSP00000027422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027422]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027422
AA Change: I413N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027422
Gene: ENSMUSG00000026220
AA Change: I413N

DomainStartEndE-ValueType
Pfam:MFS_1 42 427 6.7e-42 PFAM
Pfam:MFS_1 419 509 7.9e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,827,554 T35A Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
AI314180 G T 4: 58,847,093 Q490K probably damaging Het
Akt3 T C 1: 177,050,045 N386D possibly damaging Het
Aox2 A T 1: 58,295,887 H282L probably benign Het
Asb7 G T 7: 66,659,927 N180K possibly damaging Het
Cdh23 T C 10: 60,438,812 S500G possibly damaging Het
Cubn C T 2: 13,306,463 E3084K probably benign Het
Cyp2r1 G A 7: 114,553,170 T184I probably damaging Het
Dclk3 A G 9: 111,467,534 R49G probably damaging Het
Dcp1a C T 14: 30,519,570 Q446* probably null Het
Dnah9 A G 11: 66,117,626 I791T probably benign Het
Dock10 A T 1: 80,606,175 V189D possibly damaging Het
Dsg4 A G 18: 20,449,731 E142G probably benign Het
Dsp A T 13: 38,191,635 D1132V probably damaging Het
Dync2h1 A G 9: 7,147,771 M953T probably benign Het
Ero1l T C 14: 45,294,348 H251R probably damaging Het
Fer1l5 A G 1: 36,376,760 Y124C probably benign Het
Frmpd2 C A 14: 33,511,035 P404Q probably damaging Het
Gpr87 G T 3: 59,194,974 probably benign Het
Gse1 T C 8: 120,578,580 Y1217H unknown Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Irf9 T A 14: 55,605,753 D137E probably benign Het
Jup G T 11: 100,381,745 N280K probably benign Het
Kcna7 T C 7: 45,409,341 F351L probably damaging Het
Klk13 A T 7: 43,726,712 R270S probably benign Het
Msh6 C T 17: 87,986,912 R1032C probably damaging Het
Myo5a T C 9: 75,217,989 V1855A probably damaging Het
Neb T C 2: 52,221,702 T138A probably damaging Het
Nfkbie C A 17: 45,559,308 T193K probably damaging Het
Nlrp4b A G 7: 10,718,544 K613E probably benign Het
Obox6 T C 7: 15,833,556 E322G possibly damaging Het
Olfr111 T G 17: 37,530,579 S201A probably benign Het
Olfr632 A G 7: 103,937,602 D74G probably damaging Het
Olfr883 T C 9: 38,026,718 M304T probably benign Het
Parn A T 16: 13,665,971 N36K probably benign Het
Ppp6r2 A G 15: 89,280,447 E618G probably benign Het
Prdm13 A G 4: 21,679,557 L311P unknown Het
Prkaa2 T C 4: 105,036,298 T485A possibly damaging Het
Prmt2 G T 10: 76,217,413 T256K probably benign Het
Rspry1 T C 8: 94,639,589 Y362H probably damaging Het
Slc8a1 T C 17: 81,408,106 T821A probably damaging Het
Spock2 A T 10: 60,126,955 K276N probably damaging Het
Synj1 A T 16: 90,988,196 N257K probably benign Het
Taar7f T C 10: 24,049,913 L135P possibly damaging Het
Tmem132b T C 5: 125,787,554 F908S probably damaging Het
Tmem202 A T 9: 59,519,217 V222D probably benign Het
Trim33 T A 3: 103,311,454 C302* probably null Het
Tuba4a G A 1: 75,218,621 S1L Het
Tyrp1 G A 4: 80,850,684 E472K probably benign Het
V1ra8 A G 6: 90,203,264 I150V possibly damaging Het
Vmn2r87 A T 10: 130,472,311 M686K possibly damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Slc16a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slc16a14 APN 1 84922871 missense probably damaging 0.99
IGL01563:Slc16a14 APN 1 84912187 splice site probably benign
R0315:Slc16a14 UTSW 1 84912496 missense possibly damaging 0.46
R0380:Slc16a14 UTSW 1 84929530 missense possibly damaging 0.72
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1837:Slc16a14 UTSW 1 84912399 missense probably benign 0.02
R2149:Slc16a14 UTSW 1 84907399 missense probably damaging 1.00
R2293:Slc16a14 UTSW 1 84912843 missense probably benign
R3790:Slc16a14 UTSW 1 84929280 unclassified probably benign
R4016:Slc16a14 UTSW 1 84912507 nonsense probably null
R4596:Slc16a14 UTSW 1 84929357 missense probably damaging 1.00
R4637:Slc16a14 UTSW 1 84907282 missense possibly damaging 0.86
R4723:Slc16a14 UTSW 1 84913020 missense probably damaging 1.00
R5137:Slc16a14 UTSW 1 84912597 missense probably damaging 1.00
R5262:Slc16a14 UTSW 1 84912891 missense probably benign 0.00
R5410:Slc16a14 UTSW 1 84907424 missense probably damaging 0.98
R5927:Slc16a14 UTSW 1 84912267 missense possibly damaging 0.91
R5968:Slc16a14 UTSW 1 84912505 missense possibly damaging 0.70
R6052:Slc16a14 UTSW 1 84912709 missense possibly damaging 0.75
R6264:Slc16a14 UTSW 1 84907409 missense probably benign 0.30
R6290:Slc16a14 UTSW 1 84907385 missense probably benign 0.10
R7383:Slc16a14 UTSW 1 84912571 missense probably damaging 1.00
R7390:Slc16a14 UTSW 1 84929466 missense probably benign 0.25
R7535:Slc16a14 UTSW 1 84913122 missense probably damaging 1.00
R8669:Slc16a14 UTSW 1 84922884 missense probably benign 0.00
R8784:Slc16a14 UTSW 1 84913063 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATGCACTCTAAGCTCTGGG -3'
(R):5'- TGCCCGAAATCGTCAGTTTG -3'

Sequencing Primer
(F):5'- TAAGCTCTGGGCCCCTTG -3'
(R):5'- GCCCGAAATCGTCAGTTTGTATAAC -3'
Posted On2020-09-02