Incidental Mutation 'R8326:Zscan5b'
ID 644101
Institutional Source Beutler Lab
Gene Symbol Zscan5b
Ensembl Gene ENSMUSG00000058028
Gene Name zinc finger and SCAN domain containing 5B
Synonyms Zfp371, Zfg1
MMRRC Submission 067726-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8326 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 6225277-6242416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 6236946 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 232 (P232S)
Ref Sequence ENSEMBL: ENSMUSP00000072449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072662] [ENSMUST00000155314] [ENSMUST00000165445]
AlphaFold B2RTN3
Predicted Effect possibly damaging
Transcript: ENSMUST00000072662
AA Change: P232S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072449
Gene: ENSMUSG00000058028
AA Change: P232S

DomainStartEndE-ValueType
Pfam:SCAN 31 121 1.6e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155314
SMART Domains Protein: ENSMUSP00000118508
Gene: ENSMUSG00000058028

DomainStartEndE-ValueType
Pfam:SCAN 31 121 4.1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165445
AA Change: P232S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126044
Gene: ENSMUSG00000058028
AA Change: P232S

DomainStartEndE-ValueType
Pfam:SCAN 33 120 1e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,533,190 (GRCm39) T35A Het
Adgrv1 C T 13: 81,593,462 (GRCm39) R4175H probably damaging Het
Akt3 T C 1: 176,877,611 (GRCm39) N386D possibly damaging Het
Aox1 A T 1: 58,335,046 (GRCm39) H282L probably benign Het
Asb7 G T 7: 66,309,675 (GRCm39) N180K possibly damaging Het
Cdh23 T C 10: 60,274,591 (GRCm39) S500G possibly damaging Het
Cubn C T 2: 13,311,274 (GRCm39) E3084K probably benign Het
Cyp2r1 G A 7: 114,152,405 (GRCm39) T184I probably damaging Het
Dclk3 A G 9: 111,296,602 (GRCm39) R49G probably damaging Het
Dcp1a C T 14: 30,241,527 (GRCm39) Q446* probably null Het
Dnah9 A G 11: 66,008,452 (GRCm39) I791T probably benign Het
Dock10 A T 1: 80,583,892 (GRCm39) V189D possibly damaging Het
Dsg4 A G 18: 20,582,788 (GRCm39) E142G probably benign Het
Dsp A T 13: 38,375,611 (GRCm39) D1132V probably damaging Het
Dync2h1 A G 9: 7,147,771 (GRCm39) M953T probably benign Het
Ecpas G T 4: 58,847,093 (GRCm39) Q490K probably damaging Het
Ero1a T C 14: 45,531,805 (GRCm39) H251R probably damaging Het
Fer1l5 A G 1: 36,415,841 (GRCm39) Y124C probably benign Het
Frmpd2 C A 14: 33,232,992 (GRCm39) P404Q probably damaging Het
Gpr87 G T 3: 59,102,395 (GRCm39) probably benign Het
Gse1 T C 8: 121,305,319 (GRCm39) Y1217H unknown Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,934,702 (GRCm39) probably benign Het
Irf9 T A 14: 55,843,210 (GRCm39) D137E probably benign Het
Jup G T 11: 100,272,571 (GRCm39) N280K probably benign Het
Kcna7 T C 7: 45,058,765 (GRCm39) F351L probably damaging Het
Klk13 A T 7: 43,376,136 (GRCm39) R270S probably benign Het
Msh6 C T 17: 88,294,340 (GRCm39) R1032C probably damaging Het
Myo5a T C 9: 75,125,271 (GRCm39) V1855A probably damaging Het
Neb T C 2: 52,111,714 (GRCm39) T138A probably damaging Het
Nfkbie C A 17: 45,870,234 (GRCm39) T193K probably damaging Het
Nlrp4b A G 7: 10,452,471 (GRCm39) K613E probably benign Het
Obox6 T C 7: 15,567,481 (GRCm39) E322G possibly damaging Het
Or51ai2 A G 7: 103,586,809 (GRCm39) D74G probably damaging Het
Or5v1b T G 17: 37,841,470 (GRCm39) S201A probably benign Het
Or8b36 T C 9: 37,938,014 (GRCm39) M304T probably benign Het
Parn A T 16: 13,483,835 (GRCm39) N36K probably benign Het
Ppp6r2 A G 15: 89,164,650 (GRCm39) E618G probably benign Het
Prdm13 A G 4: 21,679,557 (GRCm39) L311P unknown Het
Prkaa2 T C 4: 104,893,495 (GRCm39) T485A possibly damaging Het
Prmt2 G T 10: 76,053,247 (GRCm39) T256K probably benign Het
Rspry1 T C 8: 95,366,217 (GRCm39) Y362H probably damaging Het
Slc16a14 A T 1: 84,890,066 (GRCm39) I413N possibly damaging Het
Slc8a1 T C 17: 81,715,535 (GRCm39) T821A probably damaging Het
Spock2 A T 10: 59,962,777 (GRCm39) K276N probably damaging Het
Synj1 A T 16: 90,785,084 (GRCm39) N257K probably benign Het
Taar7f T C 10: 23,925,811 (GRCm39) L135P possibly damaging Het
Tmem132b T C 5: 125,864,618 (GRCm39) F908S probably damaging Het
Tmem202 A T 9: 59,426,500 (GRCm39) V222D probably benign Het
Trim33 T A 3: 103,218,770 (GRCm39) C302* probably null Het
Tuba4a G A 1: 75,195,265 (GRCm39) S1L Het
Tyrp1 G A 4: 80,768,921 (GRCm39) E472K probably benign Het
V1ra8 A G 6: 90,180,246 (GRCm39) I150V possibly damaging Het
Vmn2r87 A T 10: 130,308,180 (GRCm39) M686K possibly damaging Het
Other mutations in Zscan5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Zscan5b APN 7 6,234,421 (GRCm39) missense probably benign 0.00
R0505:Zscan5b UTSW 7 6,242,074 (GRCm39) missense probably damaging 0.99
R0535:Zscan5b UTSW 7 6,236,911 (GRCm39) missense possibly damaging 0.72
R1401:Zscan5b UTSW 7 6,233,425 (GRCm39) missense probably damaging 1.00
R1537:Zscan5b UTSW 7 6,236,850 (GRCm39) missense probably benign 0.00
R1613:Zscan5b UTSW 7 6,233,374 (GRCm39) missense probably damaging 1.00
R1820:Zscan5b UTSW 7 6,242,162 (GRCm39) missense probably damaging 1.00
R1833:Zscan5b UTSW 7 6,241,965 (GRCm39) missense possibly damaging 0.67
R2191:Zscan5b UTSW 7 6,234,442 (GRCm39) missense possibly damaging 0.53
R3177:Zscan5b UTSW 7 6,234,345 (GRCm39) missense possibly damaging 0.86
R3277:Zscan5b UTSW 7 6,234,345 (GRCm39) missense possibly damaging 0.86
R4911:Zscan5b UTSW 7 6,242,189 (GRCm39) makesense probably null
R5624:Zscan5b UTSW 7 6,233,518 (GRCm39) missense probably benign 0.00
R8213:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8214:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8327:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8328:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8985:Zscan5b UTSW 7 6,241,834 (GRCm39) missense probably damaging 0.99
R9474:Zscan5b UTSW 7 6,234,472 (GRCm39) missense probably benign 0.00
R9717:Zscan5b UTSW 7 6,234,525 (GRCm39) missense possibly damaging 0.73
X0018:Zscan5b UTSW 7 6,233,275 (GRCm39) missense probably damaging 0.97
X0024:Zscan5b UTSW 7 6,241,948 (GRCm39) missense probably benign 0.00
X0025:Zscan5b UTSW 7 6,241,614 (GRCm39) missense probably benign 0.18
Z1177:Zscan5b UTSW 7 6,233,216 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCATCTCTCCGTGGAACAAAC -3'
(R):5'- CTGCAATTCGGGTATAAAGTGAAC -3'

Sequencing Primer
(F):5'- GTGGAACAAACACACAACCATGATTG -3'
(R):5'- TCAACTCTGGTGTTGGCT -3'
Posted On 2020-09-02