Incidental Mutation 'R8326:Rspry1'
ID 644109
Institutional Source Beutler Lab
Gene Symbol Rspry1
Ensembl Gene ENSMUSG00000050079
Gene Name ring finger and SPRY domain containing 1
Synonyms 4930470D19Rik
MMRRC Submission 067726-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.505) question?
Stock # R8326 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 94601937-94660275 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94639589 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 362 (Y362H)
Ref Sequence ENSEMBL: ENSMUSP00000057275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000211983] [ENSMUST00000212729]
AlphaFold Q8BVR6
Predicted Effect probably damaging
Transcript: ENSMUST00000060389
AA Change: Y362H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079
AA Change: Y362H

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
SPRY 358 482 2.94e-26 SMART
RING 527 561 3.93e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000211983
AA Change: Y362H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212729
AA Change: Y238H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,827,554 T35A Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
AI314180 G T 4: 58,847,093 Q490K probably damaging Het
Akt3 T C 1: 177,050,045 N386D possibly damaging Het
Aox2 A T 1: 58,295,887 H282L probably benign Het
Asb7 G T 7: 66,659,927 N180K possibly damaging Het
Cdh23 T C 10: 60,438,812 S500G possibly damaging Het
Cubn C T 2: 13,306,463 E3084K probably benign Het
Cyp2r1 G A 7: 114,553,170 T184I probably damaging Het
Dclk3 A G 9: 111,467,534 R49G probably damaging Het
Dcp1a C T 14: 30,519,570 Q446* probably null Het
Dnah9 A G 11: 66,117,626 I791T probably benign Het
Dock10 A T 1: 80,606,175 V189D possibly damaging Het
Dsg4 A G 18: 20,449,731 E142G probably benign Het
Dsp A T 13: 38,191,635 D1132V probably damaging Het
Dync2h1 A G 9: 7,147,771 M953T probably benign Het
Ero1l T C 14: 45,294,348 H251R probably damaging Het
Fer1l5 A G 1: 36,376,760 Y124C probably benign Het
Frmpd2 C A 14: 33,511,035 P404Q probably damaging Het
Gpr87 G T 3: 59,194,974 probably benign Het
Gse1 T C 8: 120,578,580 Y1217H unknown Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Irf9 T A 14: 55,605,753 D137E probably benign Het
Jup G T 11: 100,381,745 N280K probably benign Het
Kcna7 T C 7: 45,409,341 F351L probably damaging Het
Klk13 A T 7: 43,726,712 R270S probably benign Het
Msh6 C T 17: 87,986,912 R1032C probably damaging Het
Myo5a T C 9: 75,217,989 V1855A probably damaging Het
Neb T C 2: 52,221,702 T138A probably damaging Het
Nfkbie C A 17: 45,559,308 T193K probably damaging Het
Nlrp4b A G 7: 10,718,544 K613E probably benign Het
Obox6 T C 7: 15,833,556 E322G possibly damaging Het
Olfr111 T G 17: 37,530,579 S201A probably benign Het
Olfr632 A G 7: 103,937,602 D74G probably damaging Het
Olfr883 T C 9: 38,026,718 M304T probably benign Het
Parn A T 16: 13,665,971 N36K probably benign Het
Ppp6r2 A G 15: 89,280,447 E618G probably benign Het
Prdm13 A G 4: 21,679,557 L311P unknown Het
Prkaa2 T C 4: 105,036,298 T485A possibly damaging Het
Prmt2 G T 10: 76,217,413 T256K probably benign Het
Slc16a14 A T 1: 84,912,345 I413N possibly damaging Het
Slc8a1 T C 17: 81,408,106 T821A probably damaging Het
Spock2 A T 10: 60,126,955 K276N probably damaging Het
Synj1 A T 16: 90,988,196 N257K probably benign Het
Taar7f T C 10: 24,049,913 L135P possibly damaging Het
Tmem132b T C 5: 125,787,554 F908S probably damaging Het
Tmem202 A T 9: 59,519,217 V222D probably benign Het
Trim33 T A 3: 103,311,454 C302* probably null Het
Tuba4a G A 1: 75,218,621 S1L Het
Tyrp1 G A 4: 80,850,684 E472K probably benign Het
V1ra8 A G 6: 90,203,264 I150V possibly damaging Het
Vmn2r87 A T 10: 130,472,311 M686K possibly damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Rspry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rspry1 APN 8 94622986 start codon destroyed probably null 0.89
IGL00158:Rspry1 APN 8 94622980 intron probably benign
IGL01141:Rspry1 APN 8 94649855 missense probably benign 0.00
IGL01860:Rspry1 APN 8 94649816 missense probably benign 0.00
IGL02174:Rspry1 APN 8 94633140 missense possibly damaging 0.84
IGL02819:Rspry1 APN 8 94654256 missense probably benign 0.42
IGL02926:Rspry1 APN 8 94649811 missense probably damaging 1.00
IGL03366:Rspry1 APN 8 94650334 missense probably benign 0.00
R0570:Rspry1 UTSW 8 94629792 missense probably damaging 1.00
R1833:Rspry1 UTSW 8 94635488 missense probably damaging 1.00
R1988:Rspry1 UTSW 8 94632054 critical splice acceptor site probably null
R2444:Rspry1 UTSW 8 94623107 missense probably damaging 1.00
R3623:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R3624:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R4275:Rspry1 UTSW 8 94649761 missense probably benign 0.00
R4888:Rspry1 UTSW 8 94658789 missense probably benign 0.19
R5026:Rspry1 UTSW 8 94650303 missense probably damaging 1.00
R5310:Rspry1 UTSW 8 94623185 missense probably benign
R5374:Rspry1 UTSW 8 94623008 missense probably benign 0.00
R5374:Rspry1 UTSW 8 94654264 missense probably benign 0.38
R5387:Rspry1 UTSW 8 94638286 missense possibly damaging 0.95
R5517:Rspry1 UTSW 8 94636760 splice site probably null
R5631:Rspry1 UTSW 8 94629078 start codon destroyed possibly damaging 0.79
R5653:Rspry1 UTSW 8 94636611 splice site probably null
R6065:Rspry1 UTSW 8 94622987 start codon destroyed probably null 0.98
R6220:Rspry1 UTSW 8 94658750 missense probably damaging 1.00
R6276:Rspry1 UTSW 8 94623258 missense probably damaging 1.00
R6821:Rspry1 UTSW 8 94635431 nonsense probably null
R7390:Rspry1 UTSW 8 94623185 missense probably benign
R7460:Rspry1 UTSW 8 94650335 missense probably benign 0.00
R7644:Rspry1 UTSW 8 94658768 missense probably benign 0.00
R7717:Rspry1 UTSW 8 94623122 missense probably damaging 1.00
R7768:Rspry1 UTSW 8 94629841 missense probably damaging 1.00
R7940:Rspry1 UTSW 8 94623007 missense probably benign 0.22
R7978:Rspry1 UTSW 8 94623125 missense probably damaging 0.98
R8087:Rspry1 UTSW 8 94654297 missense probably benign 0.04
R8174:Rspry1 UTSW 8 94649822 missense probably damaging 0.97
R8676:Rspry1 UTSW 8 94632119 missense probably benign 0.01
R8715:Rspry1 UTSW 8 94623260 missense probably damaging 0.98
R8869:Rspry1 UTSW 8 94633152 missense probably damaging 0.97
R9253:Rspry1 UTSW 8 94622993 missense probably damaging 1.00
R9281:Rspry1 UTSW 8 94636631 missense probably damaging 1.00
R9699:Rspry1 UTSW 8 94654229 missense probably benign 0.01
X0010:Rspry1 UTSW 8 94629801 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCCCACCAGGAGCTTAAATAAGG -3'
(R):5'- TAAACGGTGCAGTGAGTCAC -3'

Sequencing Primer
(F):5'- GAAAATTCCATCCATCCTTCCCTATG -3'
(R):5'- GAATCTGGCAGCACCTAGTTACTG -3'
Posted On 2020-09-02