Incidental Mutation 'R0068:Selenbp2'
ID64413
Institutional Source Beutler Lab
Gene Symbol Selenbp2
Ensembl Gene ENSMUSG00000068877
Gene Nameselenium binding protein 2
SynonymsAP56, Lpsb2, acetaminophen-binding protein
MMRRC Submission 038359-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R0068 (G1)
Quality Score143
Status Validated
Chromosome3
Chromosomal Location94693556-94704413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94703509 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 294 (V294A)
Ref Sequence ENSEMBL: ENSMUSP00000134270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090848] [ENSMUST00000131650] [ENSMUST00000173849]
Predicted Effect probably benign
Transcript: ENSMUST00000090848
AA Change: V356A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088358
Gene: ENSMUSG00000068877
AA Change: V356A

DomainStartEndE-ValueType
Pfam:SBP56 6 472 7.8e-227 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132162
Predicted Effect probably benign
Transcript: ENSMUST00000173849
AA Change: V294A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134270
Gene: ENSMUSG00000068877
AA Change: V294A

DomainStartEndE-ValueType
Pfam:SBP56 6 62 4.4e-22 PFAM
Pfam:SBP56 57 410 4.1e-165 PFAM
Pfam:Lactonase 163 296 4.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174377
Meta Mutation Damage Score 0.1200 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.6%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,952,221 T1675A probably benign Het
Abca6 T C 11: 110,182,882 T1448A probably damaging Het
Aldoart2 G T 12: 55,565,448 E53* probably null Het
Ankra2 C T 13: 98,273,383 Q137* probably null Het
Arpc1a C T 5: 145,091,244 T21I possibly damaging Het
Arvcf T C 16: 18,396,954 probably benign Het
Ash1l C A 3: 89,007,317 S1751R probably benign Het
Bsn C A 9: 108,112,137 G2139C probably damaging Het
Ccdc148 T C 2: 58,827,617 E530G probably benign Het
Cct3 A G 3: 88,318,465 D365G probably benign Het
Chd2 A T 7: 73,484,534 S688R probably damaging Het
Crispld1 A G 1: 17,752,988 T398A possibly damaging Het
Ctbp2 A C 7: 132,990,059 V906G possibly damaging Het
Cwf19l1 A T 19: 44,131,499 Y68N probably damaging Het
Dlc1 T A 8: 36,937,721 M305L probably benign Het
Dnm1l C A 16: 16,324,019 G288C probably damaging Het
Fignl2 A T 15: 101,054,248 I51N probably damaging Het
Flnb A G 14: 7,915,290 N1474D possibly damaging Het
Ghrhr C T 6: 55,380,864 probably benign Het
Gm11639 T C 11: 104,720,822 S497P probably benign Het
Hltf G A 3: 20,059,090 R9H probably damaging Het
Hps5 A G 7: 46,777,042 probably benign Het
Itpr3 T C 17: 27,104,060 probably benign Het
Kansl1l A G 1: 66,720,888 V911A probably benign Het
Kdm3b C T 18: 34,824,774 T1064I probably benign Het
Lrriq1 T A 10: 103,063,418 Q1654L probably benign Het
Ltbp1 A G 17: 75,359,409 T1366A probably damaging Het
Mroh1 A G 15: 76,446,692 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Napb G A 2: 148,698,923 probably benign Het
Npc1 G C 18: 12,208,367 P532A probably benign Het
Nrp2 G T 1: 62,745,377 K228N possibly damaging Het
Olfr275 T A 4: 52,825,503 Y35* probably null Het
Plekhg1 A T 10: 3,940,504 K241* probably null Het
Poln T C 5: 34,077,088 probably benign Het
Ppil1 A T 17: 29,252,256 F92I probably damaging Het
Ppp1r9b T G 11: 95,001,220 F154V probably damaging Het
Ptchd3 T G 11: 121,842,972 L896R probably damaging Het
Rev3l A G 10: 39,824,831 N1775D possibly damaging Het
Rusc2 T C 4: 43,424,100 probably benign Het
Slc25a48 T C 13: 56,451,211 V118A probably damaging Het
Slc38a10 T C 11: 120,134,853 D219G probably damaging Het
Slc38a2 C T 15: 96,691,292 probably null Het
Slc39a12 A G 2: 14,435,678 E480G probably benign Het
Tab2 C A 10: 7,919,677 R347L probably damaging Het
Tas2r123 T C 6: 132,847,992 I284T possibly damaging Het
Tnks1bp1 T A 2: 85,062,352 D212E probably benign Het
Trim67 T C 8: 124,794,568 V223A probably damaging Het
Ugcg A G 4: 59,217,130 D218G probably benign Het
Vmn2r59 A G 7: 42,046,301 L229S probably damaging Het
Zfp451 A T 1: 33,777,625 L198I probably damaging Het
Other mutations in Selenbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Selenbp2 APN 3 94698144 missense possibly damaging 0.76
IGL02007:Selenbp2 APN 3 94698154 missense possibly damaging 0.67
IGL02103:Selenbp2 APN 3 94698131 missense probably null
IGL02222:Selenbp2 APN 3 94699962 missense probably damaging 1.00
IGL02441:Selenbp2 APN 3 94704064 missense probably benign 0.02
IGL03086:Selenbp2 APN 3 94699638 missense probably damaging 1.00
R0256:Selenbp2 UTSW 3 94699701 missense probably benign 0.35
R0725:Selenbp2 UTSW 3 94697502 splice site probably benign
R0879:Selenbp2 UTSW 3 94699556 missense possibly damaging 0.76
R1636:Selenbp2 UTSW 3 94696815 missense probably damaging 1.00
R3719:Selenbp2 UTSW 3 94699617 missense probably damaging 1.00
R4828:Selenbp2 UTSW 3 94704119 missense probably benign 0.27
R4962:Selenbp2 UTSW 3 94703549 missense probably damaging 0.99
R6661:Selenbp2 UTSW 3 94702514 missense probably damaging 1.00
R7201:Selenbp2 UTSW 3 94702357 missense probably benign 0.03
R7221:Selenbp2 UTSW 3 94703826 nonsense probably null
R7413:Selenbp2 UTSW 3 94700097 missense probably benign 0.03
X0050:Selenbp2 UTSW 3 94704128 missense probably damaging 0.99
Z1176:Selenbp2 UTSW 3 94698100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAAACAACTCTAATGTAACGTCCAC -3'
(R):5'- TGCCCACTTGGCATACCAGC -3'

Sequencing Primer
(F):5'- ttggtggtgatggtggtg -3'
(R):5'- CTGGATCCCAAAGCATCCAA -3'
Posted On2013-08-06