Incidental Mutation 'R8326:Parn'
ID644131
Institutional Source Beutler Lab
Gene Symbol Parn
Ensembl Gene ENSMUSG00000022685
Gene Namepoly(A)-specific ribonuclease (deadenylation nuclease)
SynonymsDAN, 1200003I18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R8326 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location13537960-13668170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13665971 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 36 (N36K)
Ref Sequence ENSEMBL: ENSMUSP00000055969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058884] [ENSMUST00000229042] [ENSMUST00000231003]
Predicted Effect probably benign
Transcript: ENSMUST00000058884
AA Change: N36K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: N36K

DomainStartEndE-ValueType
Pfam:CAF1 3 383 2.7e-86 PFAM
Pfam:R3H 172 236 2.8e-13 PFAM
Pfam:RNA_bind 430 508 2.2e-37 PFAM
low complexity region 564 578 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229042
AA Change: N36K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000231003
AA Change: N36K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,827,554 T35A Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
AI314180 G T 4: 58,847,093 Q490K probably damaging Het
Akt3 T C 1: 177,050,045 N386D possibly damaging Het
Aox2 A T 1: 58,295,887 H282L probably benign Het
Asb7 G T 7: 66,659,927 N180K possibly damaging Het
Cdh23 T C 10: 60,438,812 S500G possibly damaging Het
Cubn C T 2: 13,306,463 E3084K probably benign Het
Cyp2r1 G A 7: 114,553,170 T184I probably damaging Het
Dclk3 A G 9: 111,467,534 R49G probably damaging Het
Dcp1a C T 14: 30,519,570 Q446* probably null Het
Dnah9 A G 11: 66,117,626 I791T probably benign Het
Dock10 A T 1: 80,606,175 V189D possibly damaging Het
Dsg4 A G 18: 20,449,731 E142G probably benign Het
Dsp A T 13: 38,191,635 D1132V probably damaging Het
Dync2h1 A G 9: 7,147,771 M953T probably benign Het
Ero1l T C 14: 45,294,348 H251R probably damaging Het
Fer1l5 A G 1: 36,376,760 Y124C probably benign Het
Frmpd2 C A 14: 33,511,035 P404Q probably damaging Het
Gpr87 G T 3: 59,194,974 probably benign Het
Gse1 T C 8: 120,578,580 Y1217H unknown Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Irf9 T A 14: 55,605,753 D137E probably benign Het
Jup G T 11: 100,381,745 N280K probably benign Het
Kcna7 T C 7: 45,409,341 F351L probably damaging Het
Klk13 A T 7: 43,726,712 R270S probably benign Het
Msh6 C T 17: 87,986,912 R1032C probably damaging Het
Myo5a T C 9: 75,217,989 V1855A probably damaging Het
Neb T C 2: 52,221,702 T138A probably damaging Het
Nfkbie C A 17: 45,559,308 T193K probably damaging Het
Nlrp4b A G 7: 10,718,544 K613E probably benign Het
Obox6 T C 7: 15,833,556 E322G possibly damaging Het
Olfr111 T G 17: 37,530,579 S201A probably benign Het
Olfr632 A G 7: 103,937,602 D74G probably damaging Het
Olfr883 T C 9: 38,026,718 M304T probably benign Het
Ppp6r2 A G 15: 89,280,447 E618G probably benign Het
Prdm13 A G 4: 21,679,557 L311P unknown Het
Prkaa2 T C 4: 105,036,298 T485A possibly damaging Het
Prmt2 G T 10: 76,217,413 T256K probably benign Het
Rspry1 T C 8: 94,639,589 Y362H probably damaging Het
Slc16a14 A T 1: 84,912,345 I413N possibly damaging Het
Slc8a1 T C 17: 81,408,106 T821A probably damaging Het
Spock2 A T 10: 60,126,955 K276N probably damaging Het
Synj1 A T 16: 90,988,196 N257K probably benign Het
Taar7f T C 10: 24,049,913 L135P possibly damaging Het
Tmem132b T C 5: 125,787,554 F908S probably damaging Het
Tmem202 A T 9: 59,519,217 V222D probably benign Het
Trim33 T A 3: 103,311,454 C302* probably null Het
Tuba4a G A 1: 75,218,621 S1L Het
Tyrp1 G A 4: 80,850,684 E472K probably benign Het
V1ra8 A G 6: 90,203,264 I150V possibly damaging Het
Vmn2r87 A T 10: 130,472,311 M686K possibly damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Parn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Parn APN 16 13667603 missense probably benign
IGL02030:Parn APN 16 13664650 splice site probably null
IGL02179:Parn APN 16 13667592 missense probably benign 0.00
IGL02336:Parn APN 16 13566703 missense probably damaging 1.00
arlette UTSW 16 13606171 missense probably damaging 1.00
PIT4453001:Parn UTSW 16 13607281 missense probably benign 0.00
PIT4651001:Parn UTSW 16 13631567 missense probably benign 0.25
R0388:Parn UTSW 16 13654476 missense possibly damaging 0.72
R0485:Parn UTSW 16 13654435 splice site probably benign
R0625:Parn UTSW 16 13640294 missense probably benign 0.02
R1104:Parn UTSW 16 13667585 missense probably damaging 0.99
R1299:Parn UTSW 16 13664729 missense probably benign 0.10
R1356:Parn UTSW 16 13650674 nonsense probably null
R2067:Parn UTSW 16 13603069 missense probably damaging 1.00
R2111:Parn UTSW 16 13603069 missense probably damaging 1.00
R2397:Parn UTSW 16 13566654 missense probably benign
R4473:Parn UTSW 16 13664685 missense probably benign 0.00
R4474:Parn UTSW 16 13664685 missense probably benign 0.00
R4475:Parn UTSW 16 13664685 missense probably benign 0.00
R4476:Parn UTSW 16 13664685 missense probably benign 0.00
R4665:Parn UTSW 16 13541103 missense probably benign 0.19
R4795:Parn UTSW 16 13606202 missense probably benign 0.06
R5122:Parn UTSW 16 13654447 critical splice donor site probably null
R5226:Parn UTSW 16 13625552 missense probably benign
R5355:Parn UTSW 16 13668022 missense possibly damaging 0.92
R5570:Parn UTSW 16 13665930 missense probably damaging 0.98
R5979:Parn UTSW 16 13606171 missense probably damaging 1.00
R6009:Parn UTSW 16 13667564 missense probably damaging 1.00
R6173:Parn UTSW 16 13651811 missense possibly damaging 0.82
R6493:Parn UTSW 16 13656925 missense probably damaging 1.00
R7055:Parn UTSW 16 13626134 missense possibly damaging 0.80
R7278:Parn UTSW 16 13626063 splice site probably null
R7391:Parn UTSW 16 13668006 splice site probably null
R7706:Parn UTSW 16 13607253 missense probably damaging 1.00
R8188:Parn UTSW 16 13541156 missense probably benign 0.01
R8317:Parn UTSW 16 13541100 missense probably damaging 0.96
R8419:Parn UTSW 16 13648474 missense probably benign 0.11
R8433:Parn UTSW 16 13667549 missense probably damaging 1.00
R8475:Parn UTSW 16 13607249 critical splice donor site probably null
R8847:Parn UTSW 16 13628406 nonsense probably null
R8958:Parn UTSW 16 13648458 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ACCTCACTTAGAAAACATGCAAGTG -3'
(R):5'- AATGTAAGAATCCAGCCTAGGCC -3'

Sequencing Primer
(F):5'- GCAAGTGTAAATTTAATGATTCCGCC -3'
(R):5'- CTCATGTGCAAGGCAAGC -3'
Posted On2020-09-02