Incidental Mutation 'R8326:Olfr111'
ID 644133
Institutional Source Beutler Lab
Gene Symbol Olfr111
Ensembl Gene ENSMUSG00000090675
Gene Name olfactory receptor 111
Synonyms MOR249-1P, GA_x6K02T2PSCP-1989071-1990024
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock # R8326 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 37508030-37532449 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 37530579 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 201 (S201A)
Ref Sequence ENSEMBL: ENSMUSP00000150585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097325] [ENSMUST00000214259] [ENSMUST00000215424]
AlphaFold Q7TRK1
Predicted Effect probably benign
Transcript: ENSMUST00000097325
AA Change: S201A

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000094933
Gene: ENSMUSG00000090675
AA Change: S201A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.4e-54 PFAM
Pfam:7TM_GPCR_Srsx 35 302 1.5e-5 PFAM
Pfam:7tm_1 41 290 1.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214259
AA Change: S201A

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000215424
AA Change: S201A

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,827,554 T35A Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
AI314180 G T 4: 58,847,093 Q490K probably damaging Het
Akt3 T C 1: 177,050,045 N386D possibly damaging Het
Aox2 A T 1: 58,295,887 H282L probably benign Het
Asb7 G T 7: 66,659,927 N180K possibly damaging Het
Cdh23 T C 10: 60,438,812 S500G possibly damaging Het
Cubn C T 2: 13,306,463 E3084K probably benign Het
Cyp2r1 G A 7: 114,553,170 T184I probably damaging Het
Dclk3 A G 9: 111,467,534 R49G probably damaging Het
Dcp1a C T 14: 30,519,570 Q446* probably null Het
Dnah9 A G 11: 66,117,626 I791T probably benign Het
Dock10 A T 1: 80,606,175 V189D possibly damaging Het
Dsg4 A G 18: 20,449,731 E142G probably benign Het
Dsp A T 13: 38,191,635 D1132V probably damaging Het
Dync2h1 A G 9: 7,147,771 M953T probably benign Het
Ero1l T C 14: 45,294,348 H251R probably damaging Het
Fer1l5 A G 1: 36,376,760 Y124C probably benign Het
Frmpd2 C A 14: 33,511,035 P404Q probably damaging Het
Gpr87 G T 3: 59,194,974 probably benign Het
Gse1 T C 8: 120,578,580 Y1217H unknown Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Irf9 T A 14: 55,605,753 D137E probably benign Het
Jup G T 11: 100,381,745 N280K probably benign Het
Kcna7 T C 7: 45,409,341 F351L probably damaging Het
Klk13 A T 7: 43,726,712 R270S probably benign Het
Msh6 C T 17: 87,986,912 R1032C probably damaging Het
Myo5a T C 9: 75,217,989 V1855A probably damaging Het
Neb T C 2: 52,221,702 T138A probably damaging Het
Nfkbie C A 17: 45,559,308 T193K probably damaging Het
Nlrp4b A G 7: 10,718,544 K613E probably benign Het
Obox6 T C 7: 15,833,556 E322G possibly damaging Het
Olfr632 A G 7: 103,937,602 D74G probably damaging Het
Olfr883 T C 9: 38,026,718 M304T probably benign Het
Parn A T 16: 13,665,971 N36K probably benign Het
Ppp6r2 A G 15: 89,280,447 E618G probably benign Het
Prdm13 A G 4: 21,679,557 L311P unknown Het
Prkaa2 T C 4: 105,036,298 T485A possibly damaging Het
Prmt2 G T 10: 76,217,413 T256K probably benign Het
Rspry1 T C 8: 94,639,589 Y362H probably damaging Het
Slc16a14 A T 1: 84,912,345 I413N possibly damaging Het
Slc8a1 T C 17: 81,408,106 T821A probably damaging Het
Spock2 A T 10: 60,126,955 K276N probably damaging Het
Synj1 A T 16: 90,988,196 N257K probably benign Het
Taar7f T C 10: 24,049,913 L135P possibly damaging Het
Tmem132b T C 5: 125,787,554 F908S probably damaging Het
Tmem202 A T 9: 59,519,217 V222D probably benign Het
Trim33 T A 3: 103,311,454 C302* probably null Het
Tuba4a G A 1: 75,218,621 S1L Het
Tyrp1 G A 4: 80,850,684 E472K probably benign Het
V1ra8 A G 6: 90,203,264 I150V possibly damaging Het
Vmn2r87 A T 10: 130,472,311 M686K possibly damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Olfr111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Olfr111 APN 17 37530664 missense probably benign 0.00
IGL02472:Olfr111 APN 17 37530749 missense probably damaging 1.00
IGL02511:Olfr111 APN 17 37529979 start codon destroyed probably null 0.99
BB009:Olfr111 UTSW 17 37530184 missense probably benign 0.31
BB019:Olfr111 UTSW 17 37530184 missense probably benign 0.31
R0335:Olfr111 UTSW 17 37530642 missense probably benign 0.01
R2006:Olfr111 UTSW 17 37530706 missense probably damaging 1.00
R3757:Olfr111 UTSW 17 37530355 missense probably damaging 1.00
R4167:Olfr111 UTSW 17 37530006 missense possibly damaging 0.65
R4904:Olfr111 UTSW 17 37530631 missense probably damaging 1.00
R4952:Olfr111 UTSW 17 37530750 missense possibly damaging 0.48
R7366:Olfr111 UTSW 17 37530817 missense probably damaging 0.99
R7389:Olfr111 UTSW 17 37530657 missense possibly damaging 0.72
R7510:Olfr111 UTSW 17 37530589 missense probably damaging 0.98
R7932:Olfr111 UTSW 17 37530184 missense probably benign 0.31
R8080:Olfr111 UTSW 17 37530664 missense probably benign 0.00
R8828:Olfr111 UTSW 17 37530442 missense probably damaging 1.00
R9275:Olfr111 UTSW 17 37530928 missense probably benign 0.01
R9779:Olfr111 UTSW 17 37530157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTATCTGTAAGCCGTTAAGG -3'
(R):5'- ACGTGAAGATAGCACTGCC -3'

Sequencing Primer
(F):5'- TTATGAACAAGGCCCTGTGC -3'
(R):5'- CGTGAAGATAGCACTGCCATAATAG -3'
Posted On 2020-09-02