Incidental Mutation 'R8326:Dsg4'
ID644137
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Namedesmoglein 4
Synonymslah, CDHF13
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.631) question?
Stock #R8326 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20436175-20471821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20449731 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 142 (E142G)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
Predicted Effect probably benign
Transcript: ENSMUST00000019426
AA Change: E142G

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: E142G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,827,554 T35A Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
AI314180 G T 4: 58,847,093 Q490K probably damaging Het
Akt3 T C 1: 177,050,045 N386D possibly damaging Het
Aox2 A T 1: 58,295,887 H282L probably benign Het
Asb7 G T 7: 66,659,927 N180K possibly damaging Het
Cdh23 T C 10: 60,438,812 S500G possibly damaging Het
Cubn C T 2: 13,306,463 E3084K probably benign Het
Cyp2r1 G A 7: 114,553,170 T184I probably damaging Het
Dclk3 A G 9: 111,467,534 R49G probably damaging Het
Dcp1a C T 14: 30,519,570 Q446* probably null Het
Dnah9 A G 11: 66,117,626 I791T probably benign Het
Dock10 A T 1: 80,606,175 V189D possibly damaging Het
Dsp A T 13: 38,191,635 D1132V probably damaging Het
Dync2h1 A G 9: 7,147,771 M953T probably benign Het
Ero1l T C 14: 45,294,348 H251R probably damaging Het
Fer1l5 A G 1: 36,376,760 Y124C probably benign Het
Frmpd2 C A 14: 33,511,035 P404Q probably damaging Het
Gpr87 G T 3: 59,194,974 probably benign Het
Gse1 T C 8: 120,578,580 Y1217H unknown Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Irf9 T A 14: 55,605,753 D137E probably benign Het
Jup G T 11: 100,381,745 N280K probably benign Het
Kcna7 T C 7: 45,409,341 F351L probably damaging Het
Klk13 A T 7: 43,726,712 R270S probably benign Het
Msh6 C T 17: 87,986,912 R1032C probably damaging Het
Myo5a T C 9: 75,217,989 V1855A probably damaging Het
Neb T C 2: 52,221,702 T138A probably damaging Het
Nfkbie C A 17: 45,559,308 T193K probably damaging Het
Nlrp4b A G 7: 10,718,544 K613E probably benign Het
Obox6 T C 7: 15,833,556 E322G possibly damaging Het
Olfr111 T G 17: 37,530,579 S201A probably benign Het
Olfr632 A G 7: 103,937,602 D74G probably damaging Het
Olfr883 T C 9: 38,026,718 M304T probably benign Het
Parn A T 16: 13,665,971 N36K probably benign Het
Ppp6r2 A G 15: 89,280,447 E618G probably benign Het
Prdm13 A G 4: 21,679,557 L311P unknown Het
Prkaa2 T C 4: 105,036,298 T485A possibly damaging Het
Prmt2 G T 10: 76,217,413 T256K probably benign Het
Rspry1 T C 8: 94,639,589 Y362H probably damaging Het
Slc16a14 A T 1: 84,912,345 I413N possibly damaging Het
Slc8a1 T C 17: 81,408,106 T821A probably damaging Het
Spock2 A T 10: 60,126,955 K276N probably damaging Het
Synj1 A T 16: 90,988,196 N257K probably benign Het
Taar7f T C 10: 24,049,913 L135P possibly damaging Het
Tmem132b T C 5: 125,787,554 F908S probably damaging Het
Tmem202 A T 9: 59,519,217 V222D probably benign Het
Trim33 T A 3: 103,311,454 C302* probably null Het
Tuba4a G A 1: 75,218,621 S1L Het
Tyrp1 G A 4: 80,850,684 E472K probably benign Het
V1ra8 A G 6: 90,203,264 I150V possibly damaging Het
Vmn2r87 A T 10: 130,472,311 M686K possibly damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 splice site probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20471164 missense probably damaging 1.00
R8554:Dsg4 UTSW 18 20453043 missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20451872 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGAAGGAGCTAAGTTGGTGTCC -3'
(R):5'- GCTGATAGTTGAGTAAGCTGGC -3'

Sequencing Primer
(F):5'- AGCTAAGTTGGTGTCCCATGTACTAC -3'
(R):5'- TGAGTAAGCTGGCATGCC -3'
Posted On2020-09-02