Incidental Mutation 'R8326:Dsg4'
ID 644137
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms CDHF13, lah
MMRRC Submission 067726-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.507) question?
Stock # R8326 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20569232-20604878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20582788 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 142 (E142G)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably benign
Transcript: ENSMUST00000019426
AA Change: E142G

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: E142G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,533,190 (GRCm39) T35A Het
Adgrv1 C T 13: 81,593,462 (GRCm39) R4175H probably damaging Het
Akt3 T C 1: 176,877,611 (GRCm39) N386D possibly damaging Het
Aox1 A T 1: 58,335,046 (GRCm39) H282L probably benign Het
Asb7 G T 7: 66,309,675 (GRCm39) N180K possibly damaging Het
Cdh23 T C 10: 60,274,591 (GRCm39) S500G possibly damaging Het
Cubn C T 2: 13,311,274 (GRCm39) E3084K probably benign Het
Cyp2r1 G A 7: 114,152,405 (GRCm39) T184I probably damaging Het
Dclk3 A G 9: 111,296,602 (GRCm39) R49G probably damaging Het
Dcp1a C T 14: 30,241,527 (GRCm39) Q446* probably null Het
Dnah9 A G 11: 66,008,452 (GRCm39) I791T probably benign Het
Dock10 A T 1: 80,583,892 (GRCm39) V189D possibly damaging Het
Dsp A T 13: 38,375,611 (GRCm39) D1132V probably damaging Het
Dync2h1 A G 9: 7,147,771 (GRCm39) M953T probably benign Het
Ecpas G T 4: 58,847,093 (GRCm39) Q490K probably damaging Het
Ero1a T C 14: 45,531,805 (GRCm39) H251R probably damaging Het
Fer1l5 A G 1: 36,415,841 (GRCm39) Y124C probably benign Het
Frmpd2 C A 14: 33,232,992 (GRCm39) P404Q probably damaging Het
Gpr87 G T 3: 59,102,395 (GRCm39) probably benign Het
Gse1 T C 8: 121,305,319 (GRCm39) Y1217H unknown Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,934,702 (GRCm39) probably benign Het
Irf9 T A 14: 55,843,210 (GRCm39) D137E probably benign Het
Jup G T 11: 100,272,571 (GRCm39) N280K probably benign Het
Kcna7 T C 7: 45,058,765 (GRCm39) F351L probably damaging Het
Klk13 A T 7: 43,376,136 (GRCm39) R270S probably benign Het
Msh6 C T 17: 88,294,340 (GRCm39) R1032C probably damaging Het
Myo5a T C 9: 75,125,271 (GRCm39) V1855A probably damaging Het
Neb T C 2: 52,111,714 (GRCm39) T138A probably damaging Het
Nfkbie C A 17: 45,870,234 (GRCm39) T193K probably damaging Het
Nlrp4b A G 7: 10,452,471 (GRCm39) K613E probably benign Het
Obox6 T C 7: 15,567,481 (GRCm39) E322G possibly damaging Het
Or51ai2 A G 7: 103,586,809 (GRCm39) D74G probably damaging Het
Or5v1b T G 17: 37,841,470 (GRCm39) S201A probably benign Het
Or8b36 T C 9: 37,938,014 (GRCm39) M304T probably benign Het
Parn A T 16: 13,483,835 (GRCm39) N36K probably benign Het
Ppp6r2 A G 15: 89,164,650 (GRCm39) E618G probably benign Het
Prdm13 A G 4: 21,679,557 (GRCm39) L311P unknown Het
Prkaa2 T C 4: 104,893,495 (GRCm39) T485A possibly damaging Het
Prmt2 G T 10: 76,053,247 (GRCm39) T256K probably benign Het
Rspry1 T C 8: 95,366,217 (GRCm39) Y362H probably damaging Het
Slc16a14 A T 1: 84,890,066 (GRCm39) I413N possibly damaging Het
Slc8a1 T C 17: 81,715,535 (GRCm39) T821A probably damaging Het
Spock2 A T 10: 59,962,777 (GRCm39) K276N probably damaging Het
Synj1 A T 16: 90,785,084 (GRCm39) N257K probably benign Het
Taar7f T C 10: 23,925,811 (GRCm39) L135P possibly damaging Het
Tmem132b T C 5: 125,864,618 (GRCm39) F908S probably damaging Het
Tmem202 A T 9: 59,426,500 (GRCm39) V222D probably benign Het
Trim33 T A 3: 103,218,770 (GRCm39) C302* probably null Het
Tuba4a G A 1: 75,195,265 (GRCm39) S1L Het
Tyrp1 G A 4: 80,768,921 (GRCm39) E472K probably benign Het
V1ra8 A G 6: 90,180,246 (GRCm39) I150V possibly damaging Het
Vmn2r87 A T 10: 130,308,180 (GRCm39) M686K possibly damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20,594,383 (GRCm39) missense probably benign 0.22
IGL01723:Dsg4 APN 18 20,599,567 (GRCm39) missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20,594,361 (GRCm39) missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20,579,307 (GRCm39) splice site probably benign
IGL02553:Dsg4 APN 18 20,595,577 (GRCm39) missense probably benign
IGL02578:Dsg4 APN 18 20,604,250 (GRCm39) missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20,591,637 (GRCm39) missense probably benign 0.01
IGL02677:Dsg4 APN 18 20,597,933 (GRCm39) missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20,604,553 (GRCm39) missense probably benign
IGL02747:Dsg4 APN 18 20,579,995 (GRCm39) missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20,584,880 (GRCm39) missense probably damaging 1.00
burrito UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
woodshed UTSW 18 20,584,929 (GRCm39) nonsense probably null
R0043:Dsg4 UTSW 18 20,586,029 (GRCm39) missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20,603,936 (GRCm39) missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20,591,628 (GRCm39) missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20,594,416 (GRCm39) missense probably benign 0.00
R0622:Dsg4 UTSW 18 20,582,845 (GRCm39) missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20,587,703 (GRCm39) splice site probably benign
R0786:Dsg4 UTSW 18 20,582,429 (GRCm39) critical splice donor site probably null
R1114:Dsg4 UTSW 18 20,599,540 (GRCm39) missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20,579,929 (GRCm39) nonsense probably null
R1372:Dsg4 UTSW 18 20,582,733 (GRCm39) splice site probably null
R1382:Dsg4 UTSW 18 20,598,181 (GRCm39) missense probably benign 0.00
R1392:Dsg4 UTSW 18 20,579,304 (GRCm39) splice site probably benign
R1442:Dsg4 UTSW 18 20,595,717 (GRCm39) missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20,582,736 (GRCm39) missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20,604,646 (GRCm39) missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20,595,518 (GRCm39) nonsense probably null
R1765:Dsg4 UTSW 18 20,589,888 (GRCm39) missense probably benign 0.01
R1817:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20,604,269 (GRCm39) missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20,599,693 (GRCm39) nonsense probably null
R2097:Dsg4 UTSW 18 20,604,101 (GRCm39) missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20,594,499 (GRCm39) missense probably benign
R3551:Dsg4 UTSW 18 20,584,813 (GRCm39) missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20,604,058 (GRCm39) missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20,582,291 (GRCm39) missense probably benign
R3955:Dsg4 UTSW 18 20,582,432 (GRCm39) splice site probably null
R4006:Dsg4 UTSW 18 20,604,022 (GRCm39) missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20,591,636 (GRCm39) nonsense probably null
R4254:Dsg4 UTSW 18 20,604,595 (GRCm39) missense probably benign 0.07
R4504:Dsg4 UTSW 18 20,594,493 (GRCm39) missense probably benign 0.00
R4559:Dsg4 UTSW 18 20,603,978 (GRCm39) missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20,595,470 (GRCm39) missense probably benign 0.10
R4683:Dsg4 UTSW 18 20,594,466 (GRCm39) missense probably benign
R4700:Dsg4 UTSW 18 20,589,965 (GRCm39) missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20,579,888 (GRCm39) missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20,604,184 (GRCm39) missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20,599,678 (GRCm39) missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20,579,896 (GRCm39) missense probably benign 0.21
R5426:Dsg4 UTSW 18 20,591,541 (GRCm39) missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20,595,549 (GRCm39) nonsense probably null
R5982:Dsg4 UTSW 18 20,598,226 (GRCm39) missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20,599,724 (GRCm39) missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20,582,847 (GRCm39) missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20,604,420 (GRCm39) missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20,591,578 (GRCm39) missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20,584,909 (GRCm39) missense probably benign 0.01
R7196:Dsg4 UTSW 18 20,599,537 (GRCm39) missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20,579,323 (GRCm39) nonsense probably null
R7438:Dsg4 UTSW 18 20,599,685 (GRCm39) missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20,584,993 (GRCm39) splice site probably null
R7612:Dsg4 UTSW 18 20,604,047 (GRCm39) missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20,582,769 (GRCm39) missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20,587,726 (GRCm39) missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20,604,221 (GRCm39) missense probably damaging 1.00
R8554:Dsg4 UTSW 18 20,586,100 (GRCm39) missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20,584,929 (GRCm39) nonsense probably null
R9059:Dsg4 UTSW 18 20,604,182 (GRCm39) missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20,604,070 (GRCm39) missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20,586,047 (GRCm39) missense probably benign 0.00
R9765:Dsg4 UTSW 18 20,604,334 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGAAGGAGCTAAGTTGGTGTCC -3'
(R):5'- GCTGATAGTTGAGTAAGCTGGC -3'

Sequencing Primer
(F):5'- AGCTAAGTTGGTGTCCCATGTACTAC -3'
(R):5'- TGAGTAAGCTGGCATGCC -3'
Posted On 2020-09-02